Incidental Mutation 'R0847:Kremen2'
ID77034
Institutional Source Beutler Lab
Gene Symbol Kremen2
Ensembl Gene ENSMUSG00000040680
Gene Namekringle containing transmembrane protein 2
Synonyms2900054E04Rik, Krm2
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R0847 (G1)
Quality Score222
Status Not validated
Chromosome17
Chromosomal Location23741197-23745833 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23744660 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 50 (T50N)
Ref Sequence ENSEMBL: ENSMUSP00000046369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024702] [ENSMUST00000046525]
Predicted Effect probably benign
Transcript: ENSMUST00000024702
SMART Domains Protein: ENSMUSP00000024702
Gene: ENSMUSG00000023909

DomainStartEndE-ValueType
Pfam:HlyIII 43 254 1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000046525
AA Change: T50N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046369
Gene: ENSMUSG00000040680
AA Change: T50N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
KR 33 120 2.44e-18 SMART
Pfam:WSC 123 204 1.3e-20 PFAM
CUB 218 325 8.04e-15 SMART
Blast:CUB 351 422 8e-6 BLAST
low complexity region 446 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181605
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Med20 G A 17: 47,611,693 probably null Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Kremen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02327:Kremen2 APN 17 23743569 missense probably benign 0.11
R0057:Kremen2 UTSW 17 23743228 missense possibly damaging 0.94
R0369:Kremen2 UTSW 17 23742810 missense probably benign 0.02
R0835:Kremen2 UTSW 17 23742837 missense probably damaging 0.99
R1733:Kremen2 UTSW 17 23743399 intron probably null
R2056:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2057:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2058:Kremen2 UTSW 17 23742717 missense possibly damaging 0.94
R2173:Kremen2 UTSW 17 23742796 missense probably damaging 0.98
R5553:Kremen2 UTSW 17 23741802 unclassified probably benign
R5583:Kremen2 UTSW 17 23742255 missense probably benign 0.00
R6057:Kremen2 UTSW 17 23742705 missense probably benign 0.00
R6510:Kremen2 UTSW 17 23743655 missense possibly damaging 0.91
R7068:Kremen2 UTSW 17 23741885 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTGTACCAGGCCAGAGCAGAC -3'
(R):5'- GTTCCGTCCAAGGCACCATCTC -3'

Sequencing Primer
(F):5'- TGGTCCAGCCTTGCTGAAG -3'
(R):5'- ATGGGGACACCACATCTGC -3'
Posted On2013-10-16