Incidental Mutation 'R0847:Med20'
ID77036
Institutional Source Beutler Lab
Gene Symbol Med20
Ensembl Gene ENSMUSG00000092558
Gene Namemediator complex subunit 20
SynonymsTrfp, 1110011O05Rik, 2410115I17Rik
MMRRC Submission 039026-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R0847 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location47611582-47624418 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 47611693 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024778] [ENSMUST00000024783] [ENSMUST00000132397]
Predicted Effect probably null
Transcript: ENSMUST00000024778
SMART Domains Protein: ENSMUSP00000024778
Gene: ENSMUSG00000092558

DomainStartEndE-ValueType
Pfam:Med20 1 198 6.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024783
SMART Domains Protein: ENSMUSP00000024783
Gene: ENSMUSG00000023988

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:Bystin 140 430 1.1e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130830
Predicted Effect probably benign
Transcript: ENSMUST00000132397
SMART Domains Protein: ENSMUSP00000117658
Gene: ENSMUSG00000023984

DomainStartEndE-ValueType
Pfam:Med20 1 149 1.6e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149893
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. A mutation in this gene has been associated with a novel infantile-onset neurodegenerative movement disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,845,764 I899T probably damaging Het
Ahnak C T 19: 9,006,433 Q1694* probably null Het
AI314180 G A 4: 58,841,439 T645I probably benign Het
Cblc A T 7: 19,790,534 Y260* probably null Het
Ceacam5 A G 7: 17,757,837 T711A possibly damaging Het
Cep63 A G 9: 102,588,758 S690P probably benign Het
Chia1 A T 3: 106,131,937 I448F probably benign Het
Dmxl2 A T 9: 54,405,828 F1712I probably damaging Het
Exosc3 A G 4: 45,319,695 V109A probably damaging Het
Fxyd7 A G 7: 31,044,604 C60R probably damaging Het
Gm17349 C A 15: 99,702,408 probably benign Het
Gpn2 A G 4: 133,588,595 N199D probably benign Het
Ints12 C T 3: 133,108,842 T270M possibly damaging Het
Kdm4a C T 4: 118,164,498 E266K probably damaging Het
Kremen2 G T 17: 23,744,660 T50N probably damaging Het
Macf1 A T 4: 123,399,366 D1249E probably benign Het
Mdga2 T A 12: 66,723,080 K146N probably damaging Het
Myo18b T C 5: 112,874,488 probably benign Het
Nav3 T A 10: 109,903,857 T84S possibly damaging Het
Olfm2 A G 9: 20,668,657 V266A probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr1487 C T 19: 13,619,551 H87Y probably benign Het
Olfr810 T A 10: 129,791,458 I44F probably damaging Het
Pthlh A T 6: 147,263,268 probably null Het
Rpap3 C T 15: 97,703,201 probably null Het
Rprd2 A G 3: 95,765,413 S893P probably benign Het
Sacm1l G A 9: 123,548,862 G69D probably damaging Het
Slc27a4 T C 2: 29,811,249 S351P probably benign Het
Sobp C G 10: 43,022,419 R390P probably damaging Het
Spata7 T A 12: 98,648,430 M107K possibly damaging Het
Sri G A 5: 8,063,755 probably null Het
Stab2 T C 10: 86,969,871 I204V probably benign Het
Synm T C 7: 67,735,056 I511V probably damaging Het
Tbr1 T C 2: 61,805,029 S108P probably benign Het
Tln1 A G 4: 43,555,333 F197S probably damaging Het
Tmem167b C T 3: 108,560,221 G46R probably benign Het
Tmprss11g T C 5: 86,490,726 K301R probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm2 C T 10: 77,929,288 V960M possibly damaging Het
Ube3a G A 7: 59,276,586 D371N possibly damaging Het
Vmn2r57 A T 7: 41,428,801 F78I probably benign Het
Wisp1 T G 15: 66,919,275 C309G probably damaging Het
Other mutations in Med20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Med20 APN 17 47623000 missense possibly damaging 0.92
R0881:Med20 UTSW 17 47611680 start codon destroyed probably null 1.00
R4460:Med20 UTSW 17 47618917 missense probably benign 0.39
R4461:Med20 UTSW 17 47618917 missense probably benign 0.39
R5212:Med20 UTSW 17 47618850 missense probably benign 0.02
R5605:Med20 UTSW 17 47623144 intron probably benign
V7580:Med20 UTSW 17 47618832 missense probably damaging 1.00
V7582:Med20 UTSW 17 47618832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGAGGCCGGAAGTTCCTCATC -3'
(R):5'- AAGAGAGAAGTCCCACGCAGTGTC -3'

Sequencing Primer
(F):5'- CTATTACTCTCAGGAAGAGCTTCGG -3'
(R):5'- ACGCAGTGTCCCCCATC -3'
Posted On2013-10-16