Incidental Mutation 'R0849:Cntn4'
ID77060
Institutional Source Beutler Lab
Gene Symbol Cntn4
Ensembl Gene ENSMUSG00000064293
Gene Namecontactin 4
SynonymsBIG-2A, Axcam
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R0849 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location105677660-106699310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106667457 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 622 (D622V)
Ref Sequence ENSEMBL: ENSMUSP00000108889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079416] [ENSMUST00000089208] [ENSMUST00000113260] [ENSMUST00000113261] [ENSMUST00000113264]
Predicted Effect probably damaging
Transcript: ENSMUST00000079416
AA Change: D622V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293
AA Change: D622V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089208
AA Change: D622V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293
AA Change: D622V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113260
AA Change: D622V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108885
Gene: ENSMUSG00000064293
AA Change: D622V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113261
AA Change: D622V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108886
Gene: ENSMUSG00000064293
AA Change: D622V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113264
AA Change: D622V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293
AA Change: D622V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204621
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cand2 A G 6: 115,792,391 T721A probably damaging Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Cntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cntn4 APN 6 106506225 missense probably damaging 1.00
IGL00725:Cntn4 APN 6 106662655 missense probably damaging 1.00
IGL01062:Cntn4 APN 6 106618278 splice site probably benign
IGL01432:Cntn4 APN 6 106678334 splice site probably benign
IGL01585:Cntn4 APN 6 106618328 nonsense probably null
IGL01710:Cntn4 APN 6 106550431 missense possibly damaging 0.87
IGL01870:Cntn4 APN 6 106489715 missense possibly damaging 0.95
IGL01933:Cntn4 APN 6 106694384 missense probably damaging 0.99
IGL01937:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL01945:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL02007:Cntn4 APN 6 106655529 missense probably benign 0.03
IGL02506:Cntn4 APN 6 106618388 missense probably benign 0.24
IGL02561:Cntn4 APN 6 106523509 missense probably damaging 1.00
IGL03080:Cntn4 APN 6 106655539 missense probably damaging 1.00
IGL03338:Cntn4 APN 6 106655589 missense probably damaging 0.98
IGL03097:Cntn4 UTSW 6 106353712 missense probably benign 0.10
LCD18:Cntn4 UTSW 6 106553940 intron probably benign
R0083:Cntn4 UTSW 6 106525369 missense possibly damaging 0.79
R0098:Cntn4 UTSW 6 106618424 splice site probably benign
R0501:Cntn4 UTSW 6 106618335 missense probably damaging 1.00
R0626:Cntn4 UTSW 6 106662578 missense probably benign 0.07
R0633:Cntn4 UTSW 6 106679248 splice site probably null
R0730:Cntn4 UTSW 6 106550486 missense probably damaging 1.00
R0883:Cntn4 UTSW 6 106667540 splice site probably benign
R0926:Cntn4 UTSW 6 106655581 missense probably benign 0.21
R1199:Cntn4 UTSW 6 106353597 splice site probably benign
R1293:Cntn4 UTSW 6 106353724 missense probably benign 0.00
R1296:Cntn4 UTSW 6 106509402 missense probably damaging 1.00
R1344:Cntn4 UTSW 6 106344870 splice site probably null
R1418:Cntn4 UTSW 6 106344870 splice site probably null
R1660:Cntn4 UTSW 6 106679297 missense probably benign 0.35
R1751:Cntn4 UTSW 6 106618410 critical splice donor site probably null
R1883:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1884:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1899:Cntn4 UTSW 6 106675813 missense probably benign 0.21
R1906:Cntn4 UTSW 6 106353646 missense probably benign 0.00
R2048:Cntn4 UTSW 6 106437864 splice site probably benign
R2113:Cntn4 UTSW 6 106489697 missense probably damaging 1.00
R3177:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3277:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3944:Cntn4 UTSW 6 106618414 missense probably benign 0.10
R4401:Cntn4 UTSW 6 106489664 missense possibly damaging 0.94
R4540:Cntn4 UTSW 6 106675748 missense probably damaging 1.00
R4688:Cntn4 UTSW 6 106437949 missense probably damaging 1.00
R4697:Cntn4 UTSW 6 106525485 missense probably damaging 1.00
R4810:Cntn4 UTSW 6 106655611 missense probably benign 0.04
R4816:Cntn4 UTSW 6 106550497 missense probably benign
R4873:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4875:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4953:Cntn4 UTSW 6 106525418 missense probably benign 0.01
R5288:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5336:Cntn4 UTSW 6 106662634 missense possibly damaging 0.72
R5386:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5477:Cntn4 UTSW 6 106673950 missense possibly damaging 0.88
R5514:Cntn4 UTSW 6 106672883 missense probably damaging 1.00
R5668:Cntn4 UTSW 6 106679436 splice site silent
R6334:Cntn4 UTSW 6 106344786 missense probably benign
R6334:Cntn4 UTSW 6 106506192 missense probably benign 0.29
R6904:Cntn4 UTSW 6 106697583 missense probably benign 0.03
R6985:Cntn4 UTSW 6 106679417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAAATGATTGAGTGATTCAGTACCCCG -3'
(R):5'- GCTGATGCTCAGGTCCAGTGAC -3'

Sequencing Primer
(F):5'- CAGTACCCCGTTTAAGTAAGTAGGTC -3'
(R):5'- ATGCTCAGGTCCAGTGACATTAG -3'
Posted On2013-10-16