Incidental Mutation 'R0849:Cand2'
ID77061
Institutional Source Beutler Lab
Gene Symbol Cand2
Ensembl Gene ENSMUSG00000030319
Gene Namecullin-associated and neddylation-dissociated 2 (putative)
Synonyms2210404G23Rik, Tp120b
MMRRC Submission 039028-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0849 (G1)
Quality Score120
Status Not validated
Chromosome6
Chromosomal Location115774538-115805557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115792391 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 721 (T721A)
Ref Sequence ENSEMBL: ENSMUSP00000075377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075995]
Predicted Effect probably damaging
Transcript: ENSMUST00000075995
AA Change: T721A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075377
Gene: ENSMUSG00000030319
AA Change: T721A

DomainStartEndE-ValueType
low complexity region 325 347 N/A INTRINSIC
low complexity region 536 548 N/A INTRINSIC
low complexity region 553 562 N/A INTRINSIC
low complexity region 665 686 N/A INTRINSIC
low complexity region 736 748 N/A INTRINSIC
Pfam:HEAT 861 890 4.4e-5 PFAM
Pfam:TIP120 1044 1209 6e-64 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A C 9: 103,263,057 Y488D possibly damaging Het
Arhgap5 T C 12: 52,519,623 F1126L probably benign Het
Arhgef11 G T 3: 87,735,896 A1472S probably benign Het
Armc9 G A 1: 86,257,270 R681K probably benign Het
Atxn2 T A 5: 121,747,421 probably null Het
B3gnt6 C A 7: 98,194,743 L3F probably benign Het
Cntn2 A T 1: 132,522,386 M590K probably benign Het
Cntn4 A T 6: 106,667,457 D622V probably damaging Het
Des T G 1: 75,360,628 S71A probably benign Het
Dnah5 C A 15: 28,263,599 R827S probably damaging Het
Dstn G A 2: 143,938,535 G52S probably benign Het
Eln T A 5: 134,707,981 R704* probably null Het
Fezf2 T A 14: 12,342,607 K419N probably damaging Het
Gm2381 G A 7: 42,819,948 Q251* probably null Het
Gm9268 A G 7: 43,024,718 Y400C probably damaging Het
Grin3a G A 4: 49,665,501 R1045* probably null Het
Herc2 T A 7: 56,206,578 H3921Q probably damaging Het
Hs3st2 A G 7: 121,501,032 E367G possibly damaging Het
Hydin G A 8: 110,598,984 R4675H probably damaging Het
Irf2bp1 T C 7: 19,004,734 S100P possibly damaging Het
Itga10 A G 3: 96,652,530 I500M possibly damaging Het
Kcnt2 T C 1: 140,507,762 V496A probably damaging Het
Mansc1 T C 6: 134,610,707 D169G probably benign Het
Mdn1 T A 4: 32,741,835 S3869T probably damaging Het
Mrgprb4 G A 7: 48,199,120 T20I probably benign Het
Nek4 A G 14: 30,957,296 E198G probably damaging Het
Olfr1120 G T 2: 87,358,265 V274L probably benign Het
Olfr1131 C A 2: 87,629,282 T273K possibly damaging Het
Olfr1380 G A 11: 49,564,302 C127Y probably damaging Het
Ppfia4 A T 1: 134,319,372 F537I probably benign Het
Rarb A G 14: 16,434,293 V295A probably damaging Het
Ryr1 A G 7: 29,040,679 S3941P probably damaging Het
Scnn1b A G 7: 121,912,475 N370S probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Sv2c C T 13: 95,989,811 G311D probably damaging Het
Tas2r109 T C 6: 132,980,893 I25V probably benign Het
Tbcel A C 9: 42,437,157 I305S probably damaging Het
Tmem35b A G 4: 127,126,197 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Tmtc4 A G 14: 122,945,554 I244T possibly damaging Het
Usp9y C A Y: 1,394,002 C576F probably damaging Het
Vcan A T 13: 89,704,953 N629K possibly damaging Het
Vmn2r22 T C 6: 123,637,404 Y409C probably damaging Het
Other mutations in Cand2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Cand2 APN 6 115785125 missense probably benign
IGL01329:Cand2 APN 6 115782794 missense probably benign 0.43
IGL01777:Cand2 APN 6 115792857 missense probably damaging 0.99
IGL02008:Cand2 APN 6 115803638 missense probably damaging 1.00
IGL02185:Cand2 APN 6 115789510 missense probably benign 0.01
IGL02219:Cand2 APN 6 115803812 missense probably damaging 1.00
IGL02240:Cand2 APN 6 115803662 missense probably damaging 1.00
IGL02329:Cand2 APN 6 115789607 missense probably damaging 1.00
IGL02396:Cand2 APN 6 115791188 splice site probably benign
IGL02893:Cand2 APN 6 115791960 missense probably damaging 1.00
IGL03161:Cand2 APN 6 115792737 missense probably benign 0.45
IGL03170:Cand2 APN 6 115797900 missense probably damaging 1.00
IGL03257:Cand2 APN 6 115799983 missense possibly damaging 0.80
succor UTSW 6 115791192 missense probably damaging 1.00
R0196:Cand2 UTSW 6 115789502 missense probably damaging 1.00
R0390:Cand2 UTSW 6 115774653 missense possibly damaging 0.90
R0534:Cand2 UTSW 6 115787236 missense probably damaging 0.96
R0630:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0631:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0662:Cand2 UTSW 6 115787210 missense probably benign 0.00
R0671:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0708:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R1992:Cand2 UTSW 6 115785132 missense possibly damaging 0.88
R3428:Cand2 UTSW 6 115789707 missense probably benign
R3773:Cand2 UTSW 6 115785217 missense probably damaging 0.96
R4329:Cand2 UTSW 6 115799988 missense possibly damaging 0.64
R4489:Cand2 UTSW 6 115789466 missense probably damaging 1.00
R4553:Cand2 UTSW 6 115792211 missense probably damaging 1.00
R4577:Cand2 UTSW 6 115791259 missense probably damaging 1.00
R4634:Cand2 UTSW 6 115797987 missense probably damaging 1.00
R4850:Cand2 UTSW 6 115801948 missense probably benign 0.14
R5155:Cand2 UTSW 6 115792258 missense probably benign 0.42
R5190:Cand2 UTSW 6 115789513 missense probably damaging 1.00
R5378:Cand2 UTSW 6 115801951 missense probably benign 0.00
R5407:Cand2 UTSW 6 115785200 missense possibly damaging 0.76
R5698:Cand2 UTSW 6 115791743 missense probably damaging 1.00
R5701:Cand2 UTSW 6 115797932 missense probably damaging 0.99
R6172:Cand2 UTSW 6 115791310 missense probably benign 0.00
R6763:Cand2 UTSW 6 115799969 missense probably benign 0.00
R6920:Cand2 UTSW 6 115791289 missense possibly damaging 0.93
R7229:Cand2 UTSW 6 115791192 missense probably damaging 1.00
R7520:Cand2 UTSW 6 115785251 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCGACTTGGGGACGACCTAGAAC -3'
(R):5'- TGCAGTGAGCAGGCTAATGAGC -3'

Sequencing Primer
(F):5'- AATGAGATCACCCGGTTGC -3'
(R):5'- TAATGAGCTCCGAGTACTCCAC -3'
Posted On2013-10-16