Incidental Mutation 'R0840:Adra1a'
ID77136
Institutional Source Beutler Lab
Gene Symbol Adra1a
Ensembl Gene ENSMUSG00000045875
Gene Nameadrenergic receptor, alpha 1a
SynonymsAdra1c
MMRRC Submission 039019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0840 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66635251-66771168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66727710 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 383 (E383G)
Ref Sequence ENSEMBL: ENSMUSP00000125354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054661] [ENSMUST00000159068] [ENSMUST00000159365] [ENSMUST00000161339] [ENSMUST00000225182]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054661
AA Change: E383G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053703
Gene: ENSMUSG00000045875
AA Change: E383G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 1.7e-80 PFAM
Pfam:7TM_GPCR_Srv 44 343 4.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159068
AA Change: E383G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124570
Gene: ENSMUSG00000045875
AA Change: E383G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159365
AA Change: E383G

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124322
Gene: ENSMUSG00000045875
AA Change: E383G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 1.7e-17 PFAM
Pfam:7tm_1 43 326 1.8e-83 PFAM
Pfam:7TM_GPCR_Srv 44 343 7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161339
AA Change: E383G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125354
Gene: ENSMUSG00000045875
AA Change: E383G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 341 4.4e-18 PFAM
Pfam:7tm_1 43 326 3e-84 PFAM
Pfam:7TM_GPCR_Srv 44 343 3.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225182
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes one of several multipass transmembrane proteins that function as G protein-coupled receptors. The encoded protein binds to epinephrine and norepinephrine to mediate signaling in cells of the cardiac, nervous, and other organ systems. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mutations in this gene result in hypotension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810020O05Rik G T 6: 87,680,278 noncoding transcript Het
2700049A03Rik C G 12: 71,158,883 Q434E probably benign Het
A930011G23Rik T C 5: 99,234,688 T234A probably benign Het
Acot5 G A 12: 84,075,840 W399* probably null Het
Ahnak T A 19: 9,005,063 I1237N probably damaging Het
Bsg A G 10: 79,709,685 T28A probably damaging Het
Cacna1i A T 15: 80,358,949 I436F possibly damaging Het
Cd109 T C 9: 78,664,330 I417T probably benign Het
Cep295 A T 9: 15,334,315 D948E probably benign Het
Clcn3 C A 8: 60,929,154 V467F probably benign Het
Cntnap3 T C 13: 64,787,910 S380G possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dll4 T A 2: 119,326,485 N79K probably benign Het
Ep300 A T 15: 81,644,933 N1558I unknown Het
Fblim1 A G 4: 141,581,009 F330L possibly damaging Het
Fbxo46 T A 7: 19,137,148 M564K possibly damaging Het
Fnip1 T A 11: 54,493,181 probably benign Het
Foxl2 A T 9: 98,955,931 K91* probably null Het
Gapvd1 C A 2: 34,729,113 V83F probably benign Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Irf8 G A 8: 120,753,481 G153S probably benign Het
Kcnu1 T A 8: 25,913,684 M1K probably null Het
Krt32 G A 11: 100,081,242 P427S probably benign Het
Lrp12 A G 15: 39,876,158 S529P probably damaging Het
Mettl22 T C 16: 8,482,157 V134A probably damaging Het
Morc2b G T 17: 33,136,112 H895Q probably benign Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Nrxn3 A G 12: 90,331,793 S1367G possibly damaging Het
Olfr129 A G 17: 38,055,572 F7S probably benign Het
Olfr504 A T 7: 108,565,616 S60T probably benign Het
Pcnx3 T A 19: 5,685,701 probably null Het
Pgap2 A T 7: 102,237,448 M226L probably damaging Het
Pik3c2g A G 6: 139,896,072 I616M probably damaging Het
Pisd A G 5: 32,737,312 I380T probably damaging Het
Pkhd1 T C 1: 20,350,521 I2454V probably damaging Het
Plpp2 A G 10: 79,527,544 I151T probably benign Het
Polr3a G A 14: 24,452,200 T1295I possibly damaging Het
Pot1a T C 6: 25,748,284 probably benign Het
Prpf39 T G 12: 65,048,206 N219K probably benign Het
Rnf17 T A 14: 56,475,447 N790K probably damaging Het
Slit3 C T 11: 35,623,436 probably benign Het
Stx1a T A 5: 135,041,234 probably benign Het
Tenm3 C A 8: 48,335,742 V690F probably damaging Het
Tmcc3 A G 10: 94,578,771 I143V probably benign Het
Tmem41b G A 7: 109,981,049 S36F probably damaging Het
Trim5 A T 7: 104,265,771 W364R probably damaging Het
Ttn T C 2: 76,786,811 Y16403C probably damaging Het
Vps8 T C 16: 21,456,321 S210P probably damaging Het
Zbtb3 T A 19: 8,803,457 S145T possibly damaging Het
Zfp882 T A 8: 71,914,686 C452* probably null Het
Other mutations in Adra1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Adra1a APN 14 66637873 missense probably damaging 1.00
IGL02751:Adra1a APN 14 66727532 missense possibly damaging 0.76
IGL02755:Adra1a APN 14 66727661 missense probably benign
IGL03367:Adra1a APN 14 66637989 missense possibly damaging 0.89
R0610:Adra1a UTSW 14 66637792 missense probably damaging 1.00
R1720:Adra1a UTSW 14 66638278 missense probably damaging 1.00
R1902:Adra1a UTSW 14 66638235 missense probably benign 0.30
R2131:Adra1a UTSW 14 66727532 missense possibly damaging 0.76
R2198:Adra1a UTSW 14 66637936 missense probably damaging 1.00
R4702:Adra1a UTSW 14 66637559 start gained probably benign
R4761:Adra1a UTSW 14 66727431 splice site probably null
R4784:Adra1a UTSW 14 66637824 missense probably damaging 1.00
R4814:Adra1a UTSW 14 66638032 missense probably benign 0.01
R5844:Adra1a UTSW 14 66727734 missense probably benign 0.02
R7346:Adra1a UTSW 14 66638284 missense probably benign 0.16
R7508:Adra1a UTSW 14 66637935 missense probably damaging 1.00
Z1088:Adra1a UTSW 14 66727496 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAGCCAGGAGTTCAAGAAAGCC -3'
(R):5'- GCCTTCCGAGTGGGAAAATCAACAG -3'

Sequencing Primer
(F):5'- AAGCCTTTCAGAATGTGCTGC -3'
(R):5'- TGGGAAAATCAACAGTACCTAGTGTC -3'
Posted On2013-10-16