Incidental Mutation 'R0841:Otud6b'
ID77152
Institutional Source Beutler Lab
Gene Symbol Otud6b
Ensembl Gene ENSMUSG00000040550
Gene NameOTU domain containing 6B
Synonyms
MMRRC Submission 039020-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R0841 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location14809498-14826587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14812532 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 272 (T272S)
Ref Sequence ENSEMBL: ENSMUSP00000113553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117268]
Predicted Effect probably benign
Transcript: ENSMUST00000117268
AA Change: T272S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113553
Gene: ENSMUSG00000040550
AA Change: T272S

DomainStartEndE-ValueType
coiled coil region 33 106 N/A INTRINSIC
Pfam:Peptidase_C65 129 322 9.5e-8 PFAM
Pfam:OTU 185 310 6.8e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151012
SMART Domains Protein: ENSMUSP00000120430
Gene: ENSMUSG00000040550

DomainStartEndE-ValueType
coiled coil region 9 82 N/A INTRINSIC
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ovarian tumor domain (OTU)-containing subfamily of deubiquitinating enzymes. Deubiquitinating enzymes are primarily involved in removing ubiquitin from proteins targeted for degradation. This protein may function as a negative regulator of the cell cycle in B cells. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete perinatal lethality, decreased fetal size, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Otud6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Otud6b APN 4 14811732 missense probably damaging 1.00
IGL01293:Otud6b APN 4 14822682 splice site probably benign
IGL01903:Otud6b APN 4 14818458 missense probably benign 0.10
IGL02193:Otud6b APN 4 14812543 missense probably damaging 0.96
IGL03372:Otud6b APN 4 14812519 missense possibly damaging 0.95
PIT4402001:Otud6b UTSW 4 14818185 missense probably damaging 0.99
R0587:Otud6b UTSW 4 14815661 missense probably benign 0.08
R1145:Otud6b UTSW 4 14812532 missense probably benign 0.02
R1145:Otud6b UTSW 4 14812532 missense probably benign 0.02
R1416:Otud6b UTSW 4 14818473 missense probably damaging 0.98
R1676:Otud6b UTSW 4 14825617 missense probably damaging 0.99
R4982:Otud6b UTSW 4 14815607 missense probably damaging 1.00
R5024:Otud6b UTSW 4 14826293 missense probably damaging 1.00
R5615:Otud6b UTSW 4 14818187 missense possibly damaging 0.52
R6327:Otud6b UTSW 4 14826496 unclassified probably benign
R6419:Otud6b UTSW 4 14822766 missense possibly damaging 0.95
R6713:Otud6b UTSW 4 14822739 missense probably benign 0.34
R7073:Otud6b UTSW 4 14811743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGGGCAACACACAAAACTAGTC -3'
(R):5'- TCAGCTCCTGGTGCTCATACGAAC -3'

Sequencing Primer
(F):5'- ATCACACATGCAGATGCTTTC -3'
(R):5'- TACGAACAGAGCACTCTCTGC -3'
Posted On2013-10-16