Incidental Mutation 'R0841:Aass'
ID77159
Institutional Source Beutler Lab
Gene Symbol Aass
Ensembl Gene ENSMUSG00000029695
Gene Nameaminoadipate-semialdehyde synthase
SynonymsLOR/SDH, Lorsdh
MMRRC Submission 039020-MU
Accession Numbers

NCBI RefSeq: NM_013930.4; MGI:1353573

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0841 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location23072173-23132986 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23075811 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 776 (C776S)
Ref Sequence ENSEMBL: ENSMUSP00000031707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031707]
Predicted Effect probably benign
Transcript: ENSMUST00000031707
AA Change: C776S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031707
Gene: ENSMUSG00000029695
AA Change: C776S

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
AlaDh_PNT_N 27 157 2.76e-22 SMART
AlaDh_PNT_C 197 399 7.94e-23 SMART
Pfam:Sacchrp_dh_NADP 483 598 2.8e-26 PFAM
Pfam:Sacchrp_dh_C 602 916 1.2e-88 PFAM
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: This gene encodes a bifunctional mitochondrial protein that catalyzes the first two steps in the lysine degradation pathway. The N-terminus contains lysine-ketoglutarate reductase activity and converts lysine to saccharopine, whereas the C-terminus contains saccharopine dehydrogenase activity and converts saccharopine to alpha-aminoadipate semialdehyde. Mutations in a human gene encoding a highly similar protein are associated with familial hyperlysinemia. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(10) : Targeted(2) Gene trapped(8

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Aass
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aass APN 6 23075852 missense probably benign 0.10
IGL01465:Aass APN 6 23114839 critical splice donor site probably null
IGL01617:Aass APN 6 23115150 missense possibly damaging 0.89
IGL01810:Aass APN 6 23107634 missense probably damaging 0.99
IGL02024:Aass APN 6 23113706 missense probably damaging 1.00
IGL02167:Aass APN 6 23122722 intron probably benign
IGL02339:Aass APN 6 23093966 missense probably damaging 0.99
IGL02720:Aass APN 6 23122703 intron probably benign
IGL02877:Aass APN 6 23078876 nonsense probably null
IGL02948:Aass APN 6 23094319 splice site probably benign
PIT4651001:Aass UTSW 6 23118751 missense probably benign 0.00
R0152:Aass UTSW 6 23074689 missense probably damaging 1.00
R0196:Aass UTSW 6 23109520 missense probably damaging 1.00
R0546:Aass UTSW 6 23077077 critical splice donor site probably null
R0848:Aass UTSW 6 23114985 missense probably damaging 0.98
R0942:Aass UTSW 6 23075152 splice site probably benign
R1082:Aass UTSW 6 23093908 missense probably damaging 1.00
R1159:Aass UTSW 6 23115138 missense probably damaging 0.99
R1730:Aass UTSW 6 23121019 missense probably damaging 1.00
R1818:Aass UTSW 6 23075858 critical splice acceptor site probably null
R1906:Aass UTSW 6 23072985 missense probably benign 0.00
R2004:Aass UTSW 6 23092562 nonsense probably null
R2191:Aass UTSW 6 23078866 missense possibly damaging 0.91
R3690:Aass UTSW 6 23091329 missense probably benign 0.09
R3843:Aass UTSW 6 23092496 nonsense probably null
R3879:Aass UTSW 6 23122521 missense probably damaging 1.00
R4080:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4081:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4082:Aass UTSW 6 23109498 missense possibly damaging 0.83
R4348:Aass UTSW 6 23113739 missense probably benign 0.03
R4622:Aass UTSW 6 23092330 missense probably damaging 1.00
R4701:Aass UTSW 6 23075856 nonsense probably null
R4823:Aass UTSW 6 23107691 missense probably benign
R5108:Aass UTSW 6 23094208 missense probably damaging 0.99
R5248:Aass UTSW 6 23109438 missense probably benign 0.08
R5481:Aass UTSW 6 23113476 missense probably benign 0.00
R5776:Aass UTSW 6 23107650 missense possibly damaging 0.66
R5883:Aass UTSW 6 23072994 missense probably benign 0.04
R6356:Aass UTSW 6 23093902 missense probably damaging 1.00
R6594:Aass UTSW 6 23113433 missense probably benign 0.00
R6784:Aass UTSW 6 23093896 missense probably null 1.00
R6855:Aass UTSW 6 23114845 missense probably damaging 0.97
R7184:Aass UTSW 6 23094220 missense possibly damaging 0.55
R7208:Aass UTSW 6 23074630 missense probably damaging 0.99
R7464:Aass UTSW 6 23077153 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCCAGGTCATAATCACCATCAGGGTT -3'
(R):5'- ATTGCTACAGGGTGCAGGGGTA -3'

Sequencing Primer
(F):5'- GGCCAACTAATGAGCATTAATCAG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-10-16