Incidental Mutation 'R0841:Slc17a6'
ID77162
Institutional Source Beutler Lab
Gene Symbol Slc17a6
Ensembl Gene ENSMUSG00000030500
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms2900073D12Rik, VGLUT2
MMRRC Submission 039020-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0841 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location51622006-51671119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51625315 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 41 (I41F)
Ref Sequence ENSEMBL: ENSMUSP00000146364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032710] [ENSMUST00000207945]
Predicted Effect probably benign
Transcript: ENSMUST00000032710
AA Change: I41F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032710
Gene: ENSMUSG00000030500
AA Change: I41F

DomainStartEndE-ValueType
Pfam:MFS_1 76 461 6.5e-50 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207375
Predicted Effect probably benign
Transcript: ENSMUST00000207945
AA Change: I41F

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208597
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal lethality, respiratory failure, and abnormal nervous system physiology. Heterozygous mice for one allele display abnormal miniature EPSC and reduced responses to neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Slc17a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Slc17a6 APN 7 51669115 missense probably benign 0.15
IGL01653:Slc17a6 APN 7 51668022 missense possibly damaging 0.92
IGL01993:Slc17a6 APN 7 51667957 missense possibly damaging 0.51
IGL02082:Slc17a6 APN 7 51669029 missense probably benign 0.00
IGL02212:Slc17a6 APN 7 51667470 missense possibly damaging 0.94
IGL02544:Slc17a6 APN 7 51666155 nonsense probably null
IGL02585:Slc17a6 APN 7 51625349 missense probably benign 0.00
IGL03206:Slc17a6 APN 7 51666023 splice site probably benign
IGL03396:Slc17a6 APN 7 51669092 missense probably damaging 1.00
R0137:Slc17a6 UTSW 7 51666144 missense probably benign 0.00
R0141:Slc17a6 UTSW 7 51669067 missense probably benign 0.10
R0207:Slc17a6 UTSW 7 51646180 intron probably benign
R0362:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R1037:Slc17a6 UTSW 7 51649248 splice site probably benign
R1325:Slc17a6 UTSW 7 51661552 missense probably benign 0.15
R1614:Slc17a6 UTSW 7 51646277 intron probably benign
R1625:Slc17a6 UTSW 7 51661460 missense probably benign 0.00
R1736:Slc17a6 UTSW 7 51661585 splice site probably benign
R1777:Slc17a6 UTSW 7 51646209 missense possibly damaging 0.63
R1824:Slc17a6 UTSW 7 51661546 missense probably damaging 1.00
R2249:Slc17a6 UTSW 7 51667906 missense probably damaging 1.00
R4283:Slc17a6 UTSW 7 51645076 missense probably damaging 1.00
R4910:Slc17a6 UTSW 7 51658741 missense possibly damaging 0.78
R5301:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R5523:Slc17a6 UTSW 7 51626850 nonsense probably null
R5570:Slc17a6 UTSW 7 51658756 missense probably benign 0.00
R5720:Slc17a6 UTSW 7 51625397 missense probably damaging 1.00
R5736:Slc17a6 UTSW 7 51645093 missense possibly damaging 0.78
R5765:Slc17a6 UTSW 7 51625501 missense possibly damaging 0.93
R6380:Slc17a6 UTSW 7 51667463 missense probably benign 0.02
R6989:Slc17a6 UTSW 7 51661476 missense possibly damaging 0.88
R7178:Slc17a6 UTSW 7 51667511 missense possibly damaging 0.58
R7194:Slc17a6 UTSW 7 51626892 missense probably damaging 1.00
R7325:Slc17a6 UTSW 7 51645018 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCTCGCACTCTCTAAAAGAAACG -3'
(R):5'- GTCAGTGCCCACCTCCTTGATAAC -3'

Sequencing Primer
(F):5'- ACTCTCTAAAAGAAACGAGGACAG -3'
(R):5'- TTGTTGACCATGTCCACGATG -3'
Posted On2013-10-16