Incidental Mutation 'R0841:Inpp5k'
ID77177
Institutional Source Beutler Lab
Gene Symbol Inpp5k
Ensembl Gene ENSMUSG00000006127
Gene Nameinositol polyphosphate 5-phosphatase K
Synonymsputative PI-5-phosphatase, PI-5-phosphatase related, C62, Pps
MMRRC Submission 039020-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0841 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75630988-75648871 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 75633459 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006286] [ENSMUST00000143219] [ENSMUST00000150857] [ENSMUST00000179521]
Predicted Effect probably benign
Transcript: ENSMUST00000006286
SMART Domains Protein: ENSMUSP00000006286
Gene: ENSMUSG00000006127

DomainStartEndE-ValueType
IPPc 30 345 1.03e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136605
Predicted Effect probably benign
Transcript: ENSMUST00000143219
SMART Domains Protein: ENSMUSP00000115723
Gene: ENSMUSG00000017781

DomainStartEndE-ValueType
Pfam:IP_trans 2 255 4.7e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150857
Predicted Effect probably benign
Transcript: ENSMUST00000179521
SMART Domains Protein: ENSMUSP00000137510
Gene: ENSMUSG00000017781

DomainStartEndE-ValueType
Pfam:IP_trans 2 254 3.2e-123 PFAM
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5-phosphatase activity toward polyphosphate inositol. The protein localizes to the cytosol in regions lacking actin stress fibers. It is thought that this protein may negatively regulate the actin cytoskeleton. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic lethality. Adult heterozygous mutant mice show normal food intake and adiposity but exhibit enhanced glucose homeostasis and insulin sensitivity, increased insulin action in skeletal muscle, and reduced diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik T A 4: 73,942,749 M205L probably benign Het
Aass A T 6: 23,075,811 C776S probably benign Het
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
Arhgap9 T A 10: 127,329,639 M639K probably damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml3 G A 19: 8,937,685 M635I probably benign Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Fat4 A C 3: 38,995,998 K4003T probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgfr2 G A 7: 130,261,905 P4S probably benign Het
Fgfr2 T C 7: 130,772,007 probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm9726 C T 12: 93,928,280 noncoding transcript Het
Gm9956 C A 10: 56,745,328 L29M unknown Het
Gm9956 T A 10: 56,745,329 L29Q unknown Het
Hddc3 T A 7: 80,345,653 S139T probably benign Het
Hmcn1 A T 1: 150,679,607 probably null Het
Kcnq1 A G 7: 143,107,452 K32E probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Mdn1 T C 4: 32,752,032 V4590A probably benign Het
Nip7 C A 8: 107,057,375 H82Q probably benign Het
Olfr685 A T 7: 105,180,854 V168E probably damaging Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Plxna1 A G 6: 89,332,204 V1131A probably damaging Het
Prl7a1 T A 13: 27,642,410 probably benign Het
Sipa1 C A 19: 5,654,807 A587S probably benign Het
Slc17a6 A T 7: 51,625,315 I41F probably benign Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Smg1 A T 7: 118,143,301 L3230Q possibly damaging Het
Snapc1 C T 12: 73,975,006 probably benign Het
Syne2 T C 12: 76,074,435 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Trp53rkb T C 2: 166,795,510 C129R probably benign Het
Ugt2a2 T C 5: 87,474,789 T317A probably benign Het
Ugt3a1 G A 15: 9,306,128 S121N probably benign Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Vmn2r71 A G 7: 85,618,541 T68A possibly damaging Het
Zfp7 G A 15: 76,891,504 C582Y probably damaging Het
Other mutations in Inpp5k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Inpp5k APN 11 75646820 missense possibly damaging 0.72
IGL00470:Inpp5k APN 11 75645525 missense probably benign 0.00
IGL00529:Inpp5k APN 11 75631204 unclassified probably benign
IGL01761:Inpp5k APN 11 75647677 missense possibly damaging 0.75
IGL02532:Inpp5k APN 11 75633184 unclassified probably benign
R0081:Inpp5k UTSW 11 75631147 frame shift probably null
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0520:Inpp5k UTSW 11 75639530 nonsense probably null
R1145:Inpp5k UTSW 11 75633459 unclassified probably benign
R1433:Inpp5k UTSW 11 75637491 missense probably benign 0.00
R1605:Inpp5k UTSW 11 75633481 missense probably benign 0.00
R2144:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2145:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2296:Inpp5k UTSW 11 75639487 missense probably damaging 1.00
R3783:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3784:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3785:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3787:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R5999:Inpp5k UTSW 11 75633100 missense probably damaging 0.99
R6337:Inpp5k UTSW 11 75646814 missense probably damaging 1.00
R6405:Inpp5k UTSW 11 75633178 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGATGTAACCTGTCCTCGCTTG -3'
(R):5'- AGACAAACACTTAGCTGCATGGGAG -3'

Sequencing Primer
(F):5'- AGGGGAGGAGCTTTCATCC -3'
(R):5'- GCATCAGACAAGCGACTCAAG -3'
Posted On2013-10-16