Incidental Mutation 'R0842:Apbb1ip'
ID77195
Institutional Source Beutler Lab
Gene Symbol Apbb1ip
Ensembl Gene ENSMUSG00000026786
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Synonyms9930118P07Rik, Prp48, proline-rich protein 48
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0842 (G1)
Quality Score218
Status Not validated
Chromosome2
Chromosomal Location22774094-22875653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22867666 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 432 (R432Q)
Ref Sequence ENSEMBL: ENSMUSP00000014290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014290]
PDB Structure
Crystal structure of the Ras-associating and pleckstrin-homology domains of RIAM [X-RAY DIFFRACTION]
Crystal structure of RIAM RA-PH domains in complex with GTP bound Rap1 [X-RAY DIFFRACTION]
Crystal structure of RIAM TBS1 in complex with talin R7R8 domains [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014290
AA Change: R432Q

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000014290
Gene: ENSMUSG00000026786
AA Change: R432Q

DomainStartEndE-ValueType
PDB:3ZDL|B 1 31 1e-11 PDB
low complexity region 32 39 N/A INTRINSIC
coiled coil region 62 88 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
RA 179 266 1.15e-22 SMART
low complexity region 280 299 N/A INTRINSIC
PH 314 424 2.05e-10 SMART
low complexity region 516 532 N/A INTRINSIC
low complexity region 553 570 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 622 636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and healthy with no apparent defects in platelet integrin activation and function, hemostasis, or arterial thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Apbb1ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Apbb1ip APN 2 22858280 missense possibly damaging 0.59
IGL01447:Apbb1ip APN 2 22853182 missense probably damaging 1.00
IGL02987:Apbb1ip APN 2 22867637 nonsense probably null
IGL03329:Apbb1ip APN 2 22867717 missense possibly damaging 0.92
psyops UTSW 2 22853120 nonsense probably null
Simulacrum UTSW 2 22866993 critical splice donor site probably null
R0374:Apbb1ip UTSW 2 22819705 splice site probably benign
R1678:Apbb1ip UTSW 2 22874880 synonymous probably null
R3855:Apbb1ip UTSW 2 22875175 missense unknown
R3971:Apbb1ip UTSW 2 22823494 missense unknown
R4335:Apbb1ip UTSW 2 22871562 critical splice donor site probably null
R4569:Apbb1ip UTSW 2 22849544 missense probably damaging 1.00
R4742:Apbb1ip UTSW 2 22826916 missense unknown
R4804:Apbb1ip UTSW 2 22823598 critical splice donor site probably null
R4820:Apbb1ip UTSW 2 22875253 missense unknown
R4854:Apbb1ip UTSW 2 22853202 missense possibly damaging 0.94
R4899:Apbb1ip UTSW 2 22823349 missense unknown
R4920:Apbb1ip UTSW 2 22819684 missense unknown
R5283:Apbb1ip UTSW 2 22867671 missense probably benign 0.16
R5445:Apbb1ip UTSW 2 22835948 missense possibly damaging 0.90
R6346:Apbb1ip UTSW 2 22866993 critical splice donor site probably null
R6495:Apbb1ip UTSW 2 22853120 nonsense probably null
R6542:Apbb1ip UTSW 2 22874960 missense probably benign 0.04
R6550:Apbb1ip UTSW 2 22858233 missense probably damaging 1.00
R7011:Apbb1ip UTSW 2 22835931 missense probably damaging 1.00
X0014:Apbb1ip UTSW 2 22823554 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCAAACGAAGCCGATTAACTCA -3'
(R):5'- CCGGTAGACAACCTAGACACAAGGA -3'

Sequencing Primer
(F):5'- ATCCCTGTCCTCTAGTGTGTAGATG -3'
(R):5'- tccctcagcacaccacc -3'
Posted On2013-10-16