Incidental Mutation 'R0842:Zscan29'
ID77197
Institutional Source Beutler Lab
Gene Symbol Zscan29
Ensembl Gene ENSMUSG00000050619
Gene Namezinc finger SCAN domains 29
SynonymsZfp690
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121158273-121171125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121161479 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 609 (R609S)
Ref Sequence ENSEMBL: ENSMUSP00000125987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028702] [ENSMUST00000066155] [ENSMUST00000079024] [ENSMUST00000110661] [ENSMUST00000110665] [ENSMUST00000119031] [ENSMUST00000146243] [ENSMUST00000163766]
Predicted Effect probably benign
Transcript: ENSMUST00000028702
SMART Domains Protein: ENSMUSP00000028702
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 1 276 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066155
SMART Domains Protein: ENSMUSP00000067133
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079024
AA Change: E508V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078033
Gene: ENSMUSG00000050619
AA Change: E508V

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 3e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 4.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110661
AA Change: R574S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106289
Gene: ENSMUSG00000050619
AA Change: R574S

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.4e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 7.4e-22 PFAM
low complexity region 518 532 N/A INTRINSIC
ZnF_C2H2 665 687 2.99e-4 SMART
ZnF_C2H2 693 715 2.75e-3 SMART
ZnF_C2H2 721 743 8.02e-5 SMART
ZnF_C2H2 749 771 1.13e-4 SMART
ZnF_C2H2 777 799 1.18e-2 SMART
ZnF_C2H2 805 827 1.33e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110665
SMART Domains Protein: ENSMUSP00000106293
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 236 4.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119031
SMART Domains Protein: ENSMUSP00000113052
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146243
SMART Domains Protein: ENSMUSP00000120997
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 118 4.23e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156370
Predicted Effect possibly damaging
Transcript: ENSMUST00000163766
AA Change: R609S

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125987
Gene: ENSMUSG00000050619
AA Change: R609S

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.9e-21 PFAM
Pfam:Myb_DNA-bind_4 434 519 1.3e-21 PFAM
low complexity region 553 567 N/A INTRINSIC
ZnF_C2H2 700 722 2.99e-4 SMART
ZnF_C2H2 728 750 2.75e-3 SMART
ZnF_C2H2 756 778 8.02e-5 SMART
ZnF_C2H2 784 806 1.13e-4 SMART
ZnF_C2H2 812 834 1.18e-2 SMART
ZnF_C2H2 840 862 1.33e-1 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Other mutations in Zscan29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zscan29 APN 2 121170057 missense probably damaging 1.00
IGL01938:Zscan29 APN 2 121166209 missense probably benign 0.16
IGL02220:Zscan29 APN 2 121166689 missense probably damaging 0.99
IGL02370:Zscan29 APN 2 121163833 missense probably benign 0.00
IGL02585:Zscan29 APN 2 121163876 nonsense probably null
R0284:Zscan29 UTSW 2 121166733 unclassified probably benign
R1245:Zscan29 UTSW 2 121166503 missense probably damaging 1.00
R1586:Zscan29 UTSW 2 121161160 missense probably damaging 1.00
R1654:Zscan29 UTSW 2 121164779 missense probably benign 0.06
R1958:Zscan29 UTSW 2 121169808 critical splice donor site probably null
R2073:Zscan29 UTSW 2 121160855 nonsense probably null
R2085:Zscan29 UTSW 2 121169946 nonsense probably null
R2145:Zscan29 UTSW 2 121170106 missense probably damaging 1.00
R2201:Zscan29 UTSW 2 121169402 missense probably damaging 1.00
R2875:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R2876:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R3861:Zscan29 UTSW 2 121160731 missense probably benign 0.01
R4244:Zscan29 UTSW 2 121164794 unclassified probably null
R4245:Zscan29 UTSW 2 121164794 unclassified probably null
R4447:Zscan29 UTSW 2 121169886 unclassified probably null
R4662:Zscan29 UTSW 2 121166615 missense probably benign 0.26
R4757:Zscan29 UTSW 2 121160911 missense possibly damaging 0.92
R4777:Zscan29 UTSW 2 121169324 missense probably damaging 0.96
R4905:Zscan29 UTSW 2 121161383 missense possibly damaging 0.53
R4970:Zscan29 UTSW 2 121169195 splice site probably null
R5860:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5861:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5862:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5916:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5917:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5918:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R6335:Zscan29 UTSW 2 121161436 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CATGGGAGACCGGATACCTGAGAT -3'
(R):5'- TTCAAAACGTGGAACTCACTGACCA -3'

Sequencing Primer
(F):5'- ATAAGGTCTGTCTTCCAAGCCTG -3'
(R):5'- GTGGAACTCACTGACCATTTATCTG -3'
Posted On2013-10-16