Incidental Mutation 'R0842:Tex15'
ID77213
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Nametestis expressed gene 15
Synonyms2210014E14Rik
MMRRC Submission 039021-MU
Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location33516738-33585582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33571547 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 335 (I335K)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009772
AA Change: I335K

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: I335K

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124496
AA Change: I609K

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: I609K

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Ggt6 T A 11: 72,437,262 L158* probably null Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 33575311 missense probably benign 0.18
IGL00705:Tex15 APN 8 33581592 missense probably damaging 1.00
IGL00820:Tex15 APN 8 33579006 splice site probably benign
IGL01288:Tex15 APN 8 33571384 missense probably benign 0.02
IGL01328:Tex15 APN 8 33571396 nonsense probably null
IGL01359:Tex15 APN 8 33581898 missense probably damaging 0.99
IGL01603:Tex15 APN 8 33573547 missense possibly damaging 0.93
IGL01861:Tex15 APN 8 33570689 missense probably damaging 1.00
IGL02052:Tex15 APN 8 33582465 missense probably benign 0.28
IGL02560:Tex15 APN 8 33581751 missense probably benign 0.00
IGL02677:Tex15 APN 8 33571080 missense probably benign 0.03
IGL02739:Tex15 APN 8 33581693 missense possibly damaging 0.68
Big_gulp UTSW 8 33581734 missense probably damaging 1.00
P0005:Tex15 UTSW 8 33570868 missense probably benign 0.00
P0037:Tex15 UTSW 8 33581580 missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 33571101 missense probably damaging 1.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0595:Tex15 UTSW 8 33572617 missense probably damaging 1.00
R0646:Tex15 UTSW 8 33582326 missense possibly damaging 0.83
R0688:Tex15 UTSW 8 33573500 missense probably damaging 1.00
R0987:Tex15 UTSW 8 33576847 missense probably damaging 1.00
R1084:Tex15 UTSW 8 33577004 missense probably benign 0.28
R1183:Tex15 UTSW 8 33574865 missense probably benign 0.35
R1186:Tex15 UTSW 8 33571633 missense probably benign 0.19
R1378:Tex15 UTSW 8 33575216 missense probably damaging 0.99
R1500:Tex15 UTSW 8 33575092 missense probably damaging 0.96
R1508:Tex15 UTSW 8 33576852 missense probably damaging 1.00
R1597:Tex15 UTSW 8 33571483 missense probably damaging 0.96
R1636:Tex15 UTSW 8 33576387 nonsense probably null
R1639:Tex15 UTSW 8 33570817 missense possibly damaging 0.94
R1809:Tex15 UTSW 8 33574234 missense probably benign
R1843:Tex15 UTSW 8 33576654 missense probably benign 0.27
R2029:Tex15 UTSW 8 33571274 missense probably damaging 0.99
R2228:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2229:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2245:Tex15 UTSW 8 33571496 missense possibly damaging 0.77
R2246:Tex15 UTSW 8 33582512 missense possibly damaging 0.49
R2880:Tex15 UTSW 8 33574907 nonsense probably null
R2881:Tex15 UTSW 8 33574907 nonsense probably null
R2882:Tex15 UTSW 8 33574907 nonsense probably null
R3001:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3002:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3020:Tex15 UTSW 8 33576670 missense probably damaging 1.00
R3084:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3085:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3701:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3702:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3752:Tex15 UTSW 8 33571415 missense probably benign
R4162:Tex15 UTSW 8 33581558 missense probably damaging 1.00
R4231:Tex15 UTSW 8 33572137 missense probably damaging 0.99
R4589:Tex15 UTSW 8 33557373 missense probably damaging 1.00
R4707:Tex15 UTSW 8 33582497 missense probably benign 0.00
R4773:Tex15 UTSW 8 33582732 missense probably benign 0.42
R4967:Tex15 UTSW 8 33574470 missense probably benign 0.34
R5063:Tex15 UTSW 8 33582610 missense possibly damaging 0.59
R5121:Tex15 UTSW 8 33571766 missense probably damaging 1.00
R5147:Tex15 UTSW 8 33572312 nonsense probably null
R5166:Tex15 UTSW 8 33576392 missense probably benign 0.07
R5173:Tex15 UTSW 8 33571740 missense possibly damaging 0.73
R5439:Tex15 UTSW 8 33574171 missense possibly damaging 0.93
R5537:Tex15 UTSW 8 33571613 missense probably damaging 1.00
R5580:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R5588:Tex15 UTSW 8 33577187 missense probably damaging 1.00
R5696:Tex15 UTSW 8 33573192 missense probably benign 0.01
R5734:Tex15 UTSW 8 33546336 missense probably benign 0.01
R5756:Tex15 UTSW 8 33575833 missense probably benign 0.17
R5823:Tex15 UTSW 8 33570934 missense possibly damaging 0.67
R6126:Tex15 UTSW 8 33573563 missense probably benign 0.19
R6129:Tex15 UTSW 8 33574130 missense possibly damaging 0.90
R6276:Tex15 UTSW 8 33577189 missense possibly damaging 0.93
R6374:Tex15 UTSW 8 33575912 missense probably damaging 1.00
R6430:Tex15 UTSW 8 33571301 missense probably benign 0.01
R6452:Tex15 UTSW 8 33572816 missense probably damaging 1.00
R6471:Tex15 UTSW 8 33581734 missense probably damaging 1.00
R6700:Tex15 UTSW 8 33574889 missense possibly damaging 0.93
R6918:Tex15 UTSW 8 33573184 missense probably benign 0.27
R6958:Tex15 UTSW 8 33570871 missense probably benign 0.01
R6970:Tex15 UTSW 8 33557428 missense probably benign 0.03
R7059:Tex15 UTSW 8 33574730 missense possibly damaging 0.57
R7069:Tex15 UTSW 8 33570720 missense probably benign
R7072:Tex15 UTSW 8 33575431 missense possibly damaging 0.85
R7212:Tex15 UTSW 8 33570826 nonsense probably null
R7212:Tex15 UTSW 8 33572995 missense probably damaging 1.00
R7216:Tex15 UTSW 8 33572986 missense possibly damaging 0.93
R7219:Tex15 UTSW 8 33546240 missense probably benign 0.40
R7313:Tex15 UTSW 8 33574817 missense possibly damaging 0.82
R7315:Tex15 UTSW 8 33581516 missense probably benign 0.01
X0020:Tex15 UTSW 8 33576579 missense probably benign 0.03
X0065:Tex15 UTSW 8 33575517 nonsense probably null
Z1088:Tex15 UTSW 8 33571315 missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 33571810 missense possibly damaging 0.68
Z1088:Tex15 UTSW 8 33574870 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCAGCTCAAAGGGCCATGAC -3'
(R):5'- ATGCTCCAAAGAGTGTTGCGGG -3'

Sequencing Primer
(F):5'- CCAGTAGCATTGCTGTTACAGAAC -3'
(R):5'- CCAATGCTGCACGATATAGTTC -3'
Posted On2013-10-16