Incidental Mutation 'R0842:Ggt6'
ID77226
Institutional Source Beutler Lab
Gene Symbol Ggt6
Ensembl Gene ENSMUSG00000040471
Gene Namegamma-glutamyltransferase 6
Synonyms
MMRRC Submission 039021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0842 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72435526-72438400 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 72437262 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 158 (L158*)
Ref Sequence ENSEMBL: ENSMUSP00000098463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633] [ENSMUST00000076443] [ENSMUST00000100903] [ENSMUST00000108499]
Predicted Effect probably benign
Transcript: ENSMUST00000045633
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000076443
AA Change: L196*
SMART Domains Protein: ENSMUSP00000075773
Gene: ENSMUSG00000040471
AA Change: L196*

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 124 179 1.4e-9 PFAM
Pfam:G_glu_transpept 180 276 7.6e-11 PFAM
Pfam:G_glu_transpept 327 402 1.4e-9 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 475 489 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100903
AA Change: L158*
SMART Domains Protein: ENSMUSP00000098463
Gene: ENSMUSG00000040471
AA Change: L158*

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 125 238 2.1e-11 PFAM
Pfam:G_glu_transpept 290 367 6.7e-9 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108499
SMART Domains Protein: ENSMUSP00000104139
Gene: ENSMUSG00000040471

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GGT6 belongs to the gamma-glutamyltransferase (GGT; EC 2.3.2.2) gene family. GGT is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. GGT is also key to glutathione homeostasis because it provides substrates for glutathione synthesis (Heisterkamp et al., 2008 [PubMed 18357469]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl8 C A 9: 21,835,676 Y53* probably null Het
Apbb1ip G A 2: 22,867,666 R432Q possibly damaging Het
BC005561 T A 5: 104,519,200 N529K possibly damaging Het
Catsperb A T 12: 101,463,048 Q160L probably damaging Het
Cilp2 T C 8: 69,883,118 Y410C probably damaging Het
Cntnap5a G A 1: 116,442,223 G857S probably damaging Het
Colca2 T C 9: 51,272,368 E102G probably benign Het
D630045J12Rik A T 6: 38,148,465 V1538E probably damaging Het
Dnah7a A G 1: 53,501,674 S2514P possibly damaging Het
Eme1 C T 11: 94,650,874 A41T probably benign Het
F11 T C 8: 45,252,159 Y115C probably damaging Het
Fam155a T A 8: 9,770,114 D302V probably benign Het
Fap A T 2: 62,537,001 W313R probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gm281 G A 14: 13,856,686 S475L probably benign Het
Herc2 A C 7: 56,121,705 I1072L probably benign Het
Hhat T C 1: 192,726,331 N164S probably benign Het
Klrb1 A G 6: 128,710,045 probably null Het
L3mbtl4 T A 17: 68,486,962 D320E probably benign Het
Lyst C A 13: 13,678,241 Y2275* probably null Het
Map4k3 T C 17: 80,605,983 N611S probably benign Het
Morc3 T C 16: 93,873,396 probably null Het
Mtr A C 13: 12,200,247 Y864D probably damaging Het
Myh2 C T 11: 67,179,524 A431V possibly damaging Het
Myo9a C A 9: 59,871,067 Q1369K probably benign Het
Nat3 T C 8: 67,547,997 I176T probably benign Het
Ncapd3 C T 9: 27,037,084 T54I probably benign Het
Nfyc C A 4: 120,759,377 E281D probably benign Het
Nlrp14 A G 7: 107,183,135 D513G probably benign Het
Pacsin2 T C 15: 83,379,181 E83G probably damaging Het
Plagl1 G T 10: 13,128,554 probably benign Het
Pmpcb T C 5: 21,748,774 L340P possibly damaging Het
Pou2f2 A T 7: 25,096,930 L364Q probably damaging Het
Rab1b A T 19: 5,104,669 I84N probably damaging Het
Ric3 T C 7: 109,038,880 Y222C probably damaging Het
Samhd1 A G 2: 157,123,331 V188A probably damaging Het
Socs4 T A 14: 47,289,969 H107Q probably damaging Het
Tex15 T A 8: 33,571,547 I335K possibly damaging Het
Thop1 C A 10: 81,075,577 T99K probably damaging Het
Tnik A G 3: 28,594,086 E429G possibly damaging Het
Vmn2r106 T A 17: 20,268,203 I645F probably damaging Het
Zscan29 T A 2: 121,161,479 R609S possibly damaging Het
Other mutations in Ggt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Ggt6 APN 11 72436806 missense possibly damaging 0.51
hallo UTSW 11 72437667 missense probably damaging 0.98
IGL03097:Ggt6 UTSW 11 72436813 missense possibly damaging 0.71
R0080:Ggt6 UTSW 11 72437195 missense possibly damaging 0.92
R0178:Ggt6 UTSW 11 72436818 missense possibly damaging 0.71
R0595:Ggt6 UTSW 11 72437667 missense probably damaging 0.98
R1131:Ggt6 UTSW 11 72435680 missense possibly damaging 0.82
R1606:Ggt6 UTSW 11 72437733 missense possibly damaging 0.92
R2029:Ggt6 UTSW 11 72437541 missense possibly damaging 0.90
R2359:Ggt6 UTSW 11 72437551 missense possibly damaging 0.92
R2869:Ggt6 UTSW 11 72437361 missense probably benign 0.00
R2869:Ggt6 UTSW 11 72437361 missense probably benign 0.00
R4462:Ggt6 UTSW 11 72437828 missense possibly damaging 0.52
R4608:Ggt6 UTSW 11 72437943 missense probably benign 0.04
R4735:Ggt6 UTSW 11 72436599 missense probably benign
R5431:Ggt6 UTSW 11 72437738 missense possibly damaging 0.71
R5648:Ggt6 UTSW 11 72435716 missense possibly damaging 0.46
R6390:Ggt6 UTSW 11 72436611 missense possibly damaging 0.86
R6717:Ggt6 UTSW 11 72437520 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCTGAACCTCAGAGCTTCTAAC -3'
(R):5'- TATGGCAGAACAATGGACAGAGCCC -3'

Sequencing Primer
(F):5'- GCAAGACAGTGATTCTCTACCTG -3'
(R):5'- AATGGACAGAGCCCCTTTGTG -3'
Posted On2013-10-16