Incidental Mutation 'R0843:Iqgap3'
ID77243
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
MMRRC Submission 039022-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R0843 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88108431 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 40 (D40G)
Ref Sequence ENSEMBL: ENSMUSP00000142035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000194440] [ENSMUST00000195465]
Predicted Effect probably benign
Transcript: ENSMUST00000071812
AA Change: D938G

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068
AA Change: D938G

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194440
AA Change: D40G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142035
Gene: ENSMUSG00000028068
AA Change: D40G

DomainStartEndE-ValueType
Blast:RasGAP 1 67 3e-30 BLAST
RasGAP 79 432 1e-59 SMART
Blast:RasGAP 440 524 5e-10 BLAST
Pfam:RasGAP_C 535 660 5.7e-30 PFAM
low complexity region 693 704 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194772
Predicted Effect probably benign
Transcript: ENSMUST00000195465
SMART Domains Protein: ENSMUSP00000142013
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
CH 36 145 8.5e-17 SMART
internal_repeat_1 209 379 1.33e-7 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 612 1.33e-7 PROSPERO
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,071 R228G probably benign Het
Arrdc3 T C 13: 80,890,803 probably benign Het
Cacna1d T C 14: 30,124,871 Y526C probably damaging Het
Cenpn T C 8: 116,933,306 V125A probably benign Het
Cyfip1 A T 7: 55,922,820 H963L probably benign Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
Dnmt3a T C 12: 3,872,886 probably benign Het
Dync1h1 C T 12: 110,665,213 T4448M possibly damaging Het
Efr3a T A 15: 65,837,423 probably benign Het
Fam46b T C 4: 133,486,531 S238P probably damaging Het
Fgf11 T G 11: 69,798,776 probably benign Het
Gabrr1 T A 4: 33,161,717 I347N possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hspa1b T A 17: 34,957,548 N487I possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Iyd T C 10: 3,545,663 V107A possibly damaging Het
Kctd3 A T 1: 188,996,973 L129* probably null Het
Myo7b A G 18: 31,974,084 F1286S possibly damaging Het
Olfr1256 C T 2: 89,835,616 V110I probably benign Het
Olfr591 T A 7: 103,173,119 T173S possibly damaging Het
Olfr893 T A 9: 38,209,283 F77I possibly damaging Het
Pcsk5 T A 19: 17,654,818 Y328F probably damaging Het
Plxnb1 T C 9: 109,113,701 L1810P probably benign Het
Polr2h T A 16: 20,718,899 V50E probably damaging Het
Ppm1g T C 5: 31,207,551 probably benign Het
Ptpru T A 4: 131,797,948 R741S probably benign Het
Pyroxd2 T C 19: 42,747,547 E64G probably damaging Het
Rad54b T C 4: 11,609,471 probably null Het
Rangap1 A T 15: 81,710,502 D375E probably benign Het
Rhbdf1 G A 11: 32,215,053 R107C probably damaging Het
Scaf11 T C 15: 96,431,825 E140G probably damaging Het
Slitrk6 G T 14: 110,750,098 H726N probably benign Het
Spry2 A G 14: 105,893,090 C221R probably damaging Het
Stx2 C T 5: 128,999,548 V24M probably damaging Het
Tll2 T A 19: 41,128,463 probably null Het
Ttyh3 C A 5: 140,626,446 probably null Het
Vmn2r116 T C 17: 23,400,960 V556A probably benign Het
Xpo5 T C 17: 46,222,650 probably benign Het
Zc3h3 A G 15: 75,837,479 S514P probably benign Het
Zfp277 A C 12: 40,320,600 probably null Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0442:Iqgap3 UTSW 3 88115959 missense probably damaging 0.96
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0747:Iqgap3 UTSW 3 88107503 splice site probably benign
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R1973:Iqgap3 UTSW 3 88083928 splice site probably null
R2051:Iqgap3 UTSW 3 88120167 missense probably damaging 1.00
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2352:Iqgap3 UTSW 3 88104508 missense possibly damaging 0.94
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4281:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4414:Iqgap3 UTSW 3 88096986 missense probably benign
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6344:Iqgap3 UTSW 3 88082094 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7050:Iqgap3 UTSW 3 88098913 missense probably damaging 1.00
R7144:Iqgap3 UTSW 3 88116910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCCTGGCAGAATGCAGAGAC -3'
(R):5'- TGTGTGCTGAGCAAGCACTCAC -3'

Sequencing Primer
(F):5'- TGGCAAGGGCTTTCTCAC -3'
(R):5'- TCACCACCGTGCTACCATC -3'
Posted On2013-10-16