Incidental Mutation 'R0843:Olfr893'
ID77255
Institutional Source Beutler Lab
Gene Symbol Olfr893
Ensembl Gene ENSMUSG00000093901
Gene Nameolfactory receptor 893
SynonymsGA_x6K02T2PVTD-31889215-31890153, MOR170-11
MMRRC Submission 039022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0843 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38208365-38211598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38209283 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 77 (F77I)
Ref Sequence ENSEMBL: ENSMUSP00000091390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093867] [ENSMUST00000211975]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093867
AA Change: F77I

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091390
Gene: ENSMUSG00000093901
AA Change: F77I

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 1.2e-45 PFAM
Pfam:7tm_1 43 292 8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211975
AA Change: F75I

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect unknown
Transcript: ENSMUST00000212815
AA Change: F24I
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,071 R228G probably benign Het
Arrdc3 T C 13: 80,890,803 probably benign Het
Cacna1d T C 14: 30,124,871 Y526C probably damaging Het
Cenpn T C 8: 116,933,306 V125A probably benign Het
Cyfip1 A T 7: 55,922,820 H963L probably benign Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
Dnmt3a T C 12: 3,872,886 probably benign Het
Dync1h1 C T 12: 110,665,213 T4448M possibly damaging Het
Efr3a T A 15: 65,837,423 probably benign Het
Fam46b T C 4: 133,486,531 S238P probably damaging Het
Fgf11 T G 11: 69,798,776 probably benign Het
Gabrr1 T A 4: 33,161,717 I347N possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hspa1b T A 17: 34,957,548 N487I possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Iqgap3 A G 3: 88,108,431 D40G possibly damaging Het
Iyd T C 10: 3,545,663 V107A possibly damaging Het
Kctd3 A T 1: 188,996,973 L129* probably null Het
Myo7b A G 18: 31,974,084 F1286S possibly damaging Het
Olfr1256 C T 2: 89,835,616 V110I probably benign Het
Olfr591 T A 7: 103,173,119 T173S possibly damaging Het
Pcsk5 T A 19: 17,654,818 Y328F probably damaging Het
Plxnb1 T C 9: 109,113,701 L1810P probably benign Het
Polr2h T A 16: 20,718,899 V50E probably damaging Het
Ppm1g T C 5: 31,207,551 probably benign Het
Ptpru T A 4: 131,797,948 R741S probably benign Het
Pyroxd2 T C 19: 42,747,547 E64G probably damaging Het
Rad54b T C 4: 11,609,471 probably null Het
Rangap1 A T 15: 81,710,502 D375E probably benign Het
Rhbdf1 G A 11: 32,215,053 R107C probably damaging Het
Scaf11 T C 15: 96,431,825 E140G probably damaging Het
Slitrk6 G T 14: 110,750,098 H726N probably benign Het
Spry2 A G 14: 105,893,090 C221R probably damaging Het
Stx2 C T 5: 128,999,548 V24M probably damaging Het
Tll2 T A 19: 41,128,463 probably null Het
Ttyh3 C A 5: 140,626,446 probably null Het
Vmn2r116 T C 17: 23,400,960 V556A probably benign Het
Xpo5 T C 17: 46,222,650 probably benign Het
Zc3h3 A G 15: 75,837,479 S514P probably benign Het
Zfp277 A C 12: 40,320,600 probably null Het
Other mutations in Olfr893
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Olfr893 APN 9 38209238 missense probably damaging 1.00
IGL00914:Olfr893 APN 9 38209799 intron probably null
IGL01563:Olfr893 APN 9 38209701 missense probably damaging 1.00
IGL01696:Olfr893 APN 9 38209049 unclassified probably benign
IGL02064:Olfr893 APN 9 38209578 missense probably damaging 1.00
IGL02605:Olfr893 APN 9 38209236 missense probably damaging 0.99
R0415:Olfr893 UTSW 9 38209973 missense probably benign
R0463:Olfr893 UTSW 9 38209064 missense probably benign 0.00
R1441:Olfr893 UTSW 9 38209481 missense probably damaging 1.00
R1939:Olfr893 UTSW 9 38209429 nonsense probably null
R2512:Olfr893 UTSW 9 38209374 missense probably damaging 1.00
R4890:Olfr893 UTSW 9 38209290 missense probably benign 0.00
R5439:Olfr893 UTSW 9 38209754 missense probably benign 0.00
R6918:Olfr893 UTSW 9 38209652 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCAACAATTGAATGCCATGCAGC -3'
(R):5'- CATTAGCAGGGAACACATCCGAGG -3'

Sequencing Primer
(F):5'- CATGGAGAATGACTCTTCTGTGAC -3'
(R):5'- AGGATGGCATATACCAATGGCTTAC -3'
Posted On2013-10-16