Incidental Mutation 'R0843:Dnmt3a'
ID77260
Institutional Source Beutler Lab
Gene Symbol Dnmt3a
Ensembl Gene ENSMUSG00000020661
Gene NameDNA methyltransferase 3A
Synonyms
MMRRC Submission 039022-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R0843 (G1)
Quality Score210
Status Validated
Chromosome12
Chromosomal Location3806007-3914443 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 3872886 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020991] [ENSMUST00000172509] [ENSMUST00000172719] [ENSMUST00000174483] [ENSMUST00000174817]
Predicted Effect probably benign
Transcript: ENSMUST00000020991
SMART Domains Protein: ENSMUSP00000020991
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172509
SMART Domains Protein: ENSMUSP00000133869
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 86 103 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
PWWP 212 270 1.36e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172719
SMART Domains Protein: ENSMUSP00000133501
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173197
SMART Domains Protein: ENSMUSP00000133567
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 36 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174483
SMART Domains Protein: ENSMUSP00000133938
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174817
SMART Domains Protein: ENSMUSP00000134009
Gene: ENSMUSG00000020661

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene causes developmental defects in multiple different organ systems. There is a pseudogene for this gene located on chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation become runted and die around four weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,071 R228G probably benign Het
Arrdc3 T C 13: 80,890,803 probably benign Het
Cacna1d T C 14: 30,124,871 Y526C probably damaging Het
Cenpn T C 8: 116,933,306 V125A probably benign Het
Cyfip1 A T 7: 55,922,820 H963L probably benign Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
Dync1h1 C T 12: 110,665,213 T4448M possibly damaging Het
Efr3a T A 15: 65,837,423 probably benign Het
Fam46b T C 4: 133,486,531 S238P probably damaging Het
Fgf11 T G 11: 69,798,776 probably benign Het
Gabrr1 T A 4: 33,161,717 I347N possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hspa1b T A 17: 34,957,548 N487I possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Iqgap3 A G 3: 88,108,431 D40G possibly damaging Het
Iyd T C 10: 3,545,663 V107A possibly damaging Het
Kctd3 A T 1: 188,996,973 L129* probably null Het
Myo7b A G 18: 31,974,084 F1286S possibly damaging Het
Olfr1256 C T 2: 89,835,616 V110I probably benign Het
Olfr591 T A 7: 103,173,119 T173S possibly damaging Het
Olfr893 T A 9: 38,209,283 F77I possibly damaging Het
Pcsk5 T A 19: 17,654,818 Y328F probably damaging Het
Plxnb1 T C 9: 109,113,701 L1810P probably benign Het
Polr2h T A 16: 20,718,899 V50E probably damaging Het
Ppm1g T C 5: 31,207,551 probably benign Het
Ptpru T A 4: 131,797,948 R741S probably benign Het
Pyroxd2 T C 19: 42,747,547 E64G probably damaging Het
Rad54b T C 4: 11,609,471 probably null Het
Rangap1 A T 15: 81,710,502 D375E probably benign Het
Rhbdf1 G A 11: 32,215,053 R107C probably damaging Het
Scaf11 T C 15: 96,431,825 E140G probably damaging Het
Slitrk6 G T 14: 110,750,098 H726N probably benign Het
Spry2 A G 14: 105,893,090 C221R probably damaging Het
Stx2 C T 5: 128,999,548 V24M probably damaging Het
Tll2 T A 19: 41,128,463 probably null Het
Ttyh3 C A 5: 140,626,446 probably null Het
Vmn2r116 T C 17: 23,400,960 V556A probably benign Het
Xpo5 T C 17: 46,222,650 probably benign Het
Zc3h3 A G 15: 75,837,479 S514P probably benign Het
Zfp277 A C 12: 40,320,600 probably null Het
Other mutations in Dnmt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Dnmt3a APN 12 3905622 missense probably damaging 1.00
IGL02255:Dnmt3a APN 12 3872886 splice site probably benign
IGL02815:Dnmt3a APN 12 3904226 critical splice donor site probably null
IGL03372:Dnmt3a APN 12 3902666 missense probably damaging 1.00
R0028:Dnmt3a UTSW 12 3900337 missense probably damaging 0.99
R0306:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R1055:Dnmt3a UTSW 12 3872864 missense probably benign 0.05
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1585:Dnmt3a UTSW 12 3901660 missense probably damaging 0.99
R1680:Dnmt3a UTSW 12 3873361 missense probably damaging 0.97
R1753:Dnmt3a UTSW 12 3873342 missense possibly damaging 0.54
R2055:Dnmt3a UTSW 12 3872859 missense probably benign 0.44
R2219:Dnmt3a UTSW 12 3849654 utr 5 prime probably benign
R2267:Dnmt3a UTSW 12 3897551 splice site probably null
R2359:Dnmt3a UTSW 12 3901599 missense probably damaging 1.00
R2384:Dnmt3a UTSW 12 3901591 missense probably damaging 1.00
R2403:Dnmt3a UTSW 12 3899883 missense probably damaging 1.00
R2884:Dnmt3a UTSW 12 3896132 missense probably damaging 1.00
R3027:Dnmt3a UTSW 12 3849626 splice site probably null
R4281:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4282:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4283:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4809:Dnmt3a UTSW 12 3900352 missense probably damaging 1.00
R5154:Dnmt3a UTSW 12 3896008 missense probably damaging 1.00
R5361:Dnmt3a UTSW 12 3895643 missense probably benign 0.13
R5483:Dnmt3a UTSW 12 3899615 missense probably damaging 1.00
R5768:Dnmt3a UTSW 12 3885660 splice site probably null
R5928:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R6432:Dnmt3a UTSW 12 3902399 missense probably damaging 0.99
R6552:Dnmt3a UTSW 12 3907623 missense probably damaging 1.00
R6783:Dnmt3a UTSW 12 3897406 missense probably damaging 0.99
R6850:Dnmt3a UTSW 12 3897600 missense probably benign 0.40
R7106:Dnmt3a UTSW 12 3897591 missense probably damaging 0.99
R7145:Dnmt3a UTSW 12 3872844 missense probably benign 0.01
R7149:Dnmt3a UTSW 12 3902397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGACGGCACATGAACAAGC -3'
(R):5'- TTGGCAGGGACTCATGAACAAGGC -3'

Sequencing Primer
(F):5'- GCAAACACTAGGAGGACCC -3'
(R):5'- TCTGGAGGGGGATGAGC -3'
Posted On2013-10-16