Incidental Mutation 'R0843:Scaf11'
ID77270
Institutional Source Beutler Lab
Gene Symbol Scaf11
Ensembl Gene ENSMUSG00000033228
Gene NameSR-related CTD-associated factor 11
SynonymsSrsf2ip, Sfrs2ip, SIP1, CASP11, 1110061H03Rik, SRRP129, 2610510E10Rik
MMRRC Submission 039022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R0843 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location96411699-96460843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96431825 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 140 (E140G)
Ref Sequence ENSEMBL: ENSMUSP00000154321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047835] [ENSMUST00000227069] [ENSMUST00000228535]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047835
AA Change: E140G

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044898
Gene: ENSMUSG00000033228
AA Change: E140G

DomainStartEndE-ValueType
RING 41 81 1.57e-2 SMART
low complexity region 308 327 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 919 978 N/A INTRINSIC
low complexity region 1089 1108 N/A INTRINSIC
low complexity region 1177 1188 N/A INTRINSIC
low complexity region 1283 1311 N/A INTRINSIC
low complexity region 1346 1359 N/A INTRINSIC
Blast:IG_like 1374 1415 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227069
AA Change: E140G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000228260
Predicted Effect probably damaging
Transcript: ENSMUST00000228535
AA Change: E78G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,071 R228G probably benign Het
Arrdc3 T C 13: 80,890,803 probably benign Het
Cacna1d T C 14: 30,124,871 Y526C probably damaging Het
Cenpn T C 8: 116,933,306 V125A probably benign Het
Cyfip1 A T 7: 55,922,820 H963L probably benign Het
Dnah8 T C 17: 30,813,095 Y4130H probably damaging Het
Dnmt3a T C 12: 3,872,886 probably benign Het
Dync1h1 C T 12: 110,665,213 T4448M possibly damaging Het
Efr3a T A 15: 65,837,423 probably benign Het
Fam46b T C 4: 133,486,531 S238P probably damaging Het
Fgf11 T G 11: 69,798,776 probably benign Het
Gabrr1 T A 4: 33,161,717 I347N possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hspa1b T A 17: 34,957,548 N487I possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Iqgap3 A G 3: 88,108,431 D40G possibly damaging Het
Iyd T C 10: 3,545,663 V107A possibly damaging Het
Kctd3 A T 1: 188,996,973 L129* probably null Het
Myo7b A G 18: 31,974,084 F1286S possibly damaging Het
Olfr1256 C T 2: 89,835,616 V110I probably benign Het
Olfr591 T A 7: 103,173,119 T173S possibly damaging Het
Olfr893 T A 9: 38,209,283 F77I possibly damaging Het
Pcsk5 T A 19: 17,654,818 Y328F probably damaging Het
Plxnb1 T C 9: 109,113,701 L1810P probably benign Het
Polr2h T A 16: 20,718,899 V50E probably damaging Het
Ppm1g T C 5: 31,207,551 probably benign Het
Ptpru T A 4: 131,797,948 R741S probably benign Het
Pyroxd2 T C 19: 42,747,547 E64G probably damaging Het
Rad54b T C 4: 11,609,471 probably null Het
Rangap1 A T 15: 81,710,502 D375E probably benign Het
Rhbdf1 G A 11: 32,215,053 R107C probably damaging Het
Slitrk6 G T 14: 110,750,098 H726N probably benign Het
Spry2 A G 14: 105,893,090 C221R probably damaging Het
Stx2 C T 5: 128,999,548 V24M probably damaging Het
Tll2 T A 19: 41,128,463 probably null Het
Ttyh3 C A 5: 140,626,446 probably null Het
Vmn2r116 T C 17: 23,400,960 V556A probably benign Het
Xpo5 T C 17: 46,222,650 probably benign Het
Zc3h3 A G 15: 75,837,479 S514P probably benign Het
Zfp277 A C 12: 40,320,600 probably null Het
Other mutations in Scaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Scaf11 APN 15 96418580 missense possibly damaging 0.94
IGL01386:Scaf11 APN 15 96420480 missense probably damaging 1.00
IGL01449:Scaf11 APN 15 96419126 missense probably benign 0.04
IGL01547:Scaf11 APN 15 96418429 missense probably benign 0.14
IGL01697:Scaf11 APN 15 96423623 splice site probably benign
IGL01780:Scaf11 APN 15 96420844 missense possibly damaging 0.94
IGL02311:Scaf11 APN 15 96418756 missense probably benign 0.01
IGL02740:Scaf11 APN 15 96419002 missense probably benign 0.01
IGL02805:Scaf11 APN 15 96420182 missense possibly damaging 0.69
IGL03383:Scaf11 APN 15 96420183 unclassified probably null
R0173:Scaf11 UTSW 15 96420194 missense probably benign 0.00
R0379:Scaf11 UTSW 15 96431816 missense probably damaging 1.00
R0508:Scaf11 UTSW 15 96420487 missense probably damaging 1.00
R0648:Scaf11 UTSW 15 96418458 missense possibly damaging 0.72
R0653:Scaf11 UTSW 15 96418641 nonsense probably null
R0727:Scaf11 UTSW 15 96419443 missense probably damaging 1.00
R0829:Scaf11 UTSW 15 96418689 missense probably damaging 1.00
R0839:Scaf11 UTSW 15 96423553 missense probably damaging 1.00
R0882:Scaf11 UTSW 15 96418295 missense possibly damaging 0.75
R1994:Scaf11 UTSW 15 96418840 nonsense probably null
R2092:Scaf11 UTSW 15 96415827 missense probably damaging 0.98
R2125:Scaf11 UTSW 15 96419315 missense possibly damaging 0.69
R2200:Scaf11 UTSW 15 96420523 missense probably damaging 1.00
R3409:Scaf11 UTSW 15 96414864 missense probably damaging 1.00
R3751:Scaf11 UTSW 15 96418536 missense probably damaging 0.99
R4308:Scaf11 UTSW 15 96446515 missense probably benign 0.00
R4424:Scaf11 UTSW 15 96418428 missense possibly damaging 0.78
R4519:Scaf11 UTSW 15 96424838 missense probably damaging 1.00
R4646:Scaf11 UTSW 15 96420100 unclassified probably null
R4647:Scaf11 UTSW 15 96420100 unclassified probably null
R4724:Scaf11 UTSW 15 96414848 missense probably benign 0.40
R4748:Scaf11 UTSW 15 96420421 nonsense probably null
R4926:Scaf11 UTSW 15 96418242 missense possibly damaging 0.87
R4978:Scaf11 UTSW 15 96415917 missense probably damaging 1.00
R5105:Scaf11 UTSW 15 96420432 missense probably damaging 1.00
R5120:Scaf11 UTSW 15 96419542 missense probably benign 0.26
R5277:Scaf11 UTSW 15 96419226 missense probably damaging 1.00
R5377:Scaf11 UTSW 15 96417120 missense possibly damaging 0.55
R5394:Scaf11 UTSW 15 96419458 missense probably benign 0.28
R5481:Scaf11 UTSW 15 96420617 missense probably damaging 1.00
R5831:Scaf11 UTSW 15 96417081 missense probably benign 0.14
R5941:Scaf11 UTSW 15 96420308 missense probably damaging 0.99
R6123:Scaf11 UTSW 15 96420454 missense probably benign 0.29
R6166:Scaf11 UTSW 15 96424662 missense probably damaging 1.00
R6504:Scaf11 UTSW 15 96419460 unclassified probably null
R6863:Scaf11 UTSW 15 96419419 missense probably damaging 1.00
R7135:Scaf11 UTSW 15 96420328 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGGCTACAAGGCAGGCTACTCAAC -3'
(R):5'- TGGCAAGTGGCACTCATGCATAC -3'

Sequencing Primer
(F):5'- TCAGGAGATGGTCTTTCAACAC -3'
(R):5'- TCTCGGTAGCCAGTCATGAAAG -3'
Posted On2013-10-16