Incidental Mutation 'R0846:Scn1a'
ID77354
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Namesodium channel, voltage-gated, type I, alpha
SynonymsNav1.1
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location66270778-66440840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66324755 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 620 (S620N)
Ref Sequence ENSEMBL: ENSMUSP00000107990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000138910]
Predicted Effect probably benign
Transcript: ENSMUST00000077489
AA Change: S620N

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: S620N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094951
AA Change: S620N

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: S620N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112366
AA Change: S620N

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: S620N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112371
AA Change: S620N

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: S620N

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138910
SMART Domains Protein: ENSMUSP00000116881
Gene: ENSMUSG00000064329

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Cyr61 T A 3: 145,647,770 M346L possibly damaging Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
PIT4791001:Scn1a UTSW 2 66273282 missense probably benign 0.18
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66324618 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGCAGCAATCATAGGCCAG -3'
(R):5'- GTTCTCCCCAAGACGCAATAGCAG -3'

Sequencing Primer
(F):5'- CCAGCCATGCCTGAACTATG -3'
(R):5'- AGCAGAACAAGTCTTTTCAGC -3'
Posted On2013-10-16