Incidental Mutation 'R0846:Cyr61'
ID77361
Institutional Source Beutler Lab
Gene Symbol Cyr61
Ensembl Gene ENSMUSG00000028195
Gene Namecysteine rich protein 61
SynonymsCCN1
MMRRC Submission 039025-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R0846 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145646976-145649981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145647770 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 346 (M346L)
Ref Sequence ENSEMBL: ENSMUSP00000029846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029846
AA Change: M346L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029846
Gene: ENSMUSG00000028195
AA Change: M346L

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
IB 24 93 1.16e-24 SMART
VWC 100 163 9.94e-23 SMART
low complexity region 164 184 N/A INTRINSIC
TSP1 229 271 1.34e-5 SMART
CT 289 358 3.74e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197148
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.2%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]
PHENOTYPE: Targeted null mice die pre- or perinatally, and none survive beyond 24 hrs of birth. About 30% of embryos die by E10.5 from defects in chorioallantoic fusion, whereas 70% die from placental vascular defects, including impaired allantoic vessel bifurcation, and loss of large-vessel integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,383,837 T58S probably damaging Het
Aak1 T C 6: 86,959,089 probably benign Het
Adgrv1 G A 13: 81,479,742 R3667* probably null Het
Adh5 T G 3: 138,451,074 C174G probably damaging Het
Cap1 A C 4: 122,862,899 probably null Het
Caps2 G A 10: 112,215,585 R587H probably damaging Het
Cdo1 A G 18: 46,715,745 V142A probably damaging Het
Chuk T C 19: 44,091,028 T345A probably damaging Het
Cobll1 T C 2: 65,102,065 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cop1 T C 1: 159,319,816 Y571H probably benign Het
Dcc A G 18: 71,826,212 V163A probably benign Het
Dnah11 G T 12: 117,933,850 N3548K probably damaging Het
Ehhadh G T 16: 21,773,497 S152* probably null Het
Fitm2 T C 2: 163,469,814 T160A probably benign Het
Fos C T 12: 85,475,683 T162I probably damaging Het
Fsd2 T C 7: 81,540,397 I546V probably benign Het
Gal3st2c T C 1: 94,006,947 V19A possibly damaging Het
Gm12794 A T 4: 101,941,250 K139N probably benign Het
Gm853 A C 4: 130,221,624 S44A probably benign Het
Gorasp2 T A 2: 70,690,954 S443T probably benign Het
Klf4 G A 4: 55,530,191 H307Y probably damaging Het
Mark3 A G 12: 111,627,224 D230G possibly damaging Het
Mnat1 T G 12: 73,123,932 probably null Het
Olfr1036 T C 2: 86,075,166 L142P possibly damaging Het
Otogl T G 10: 107,772,296 T2073P probably benign Het
Pdxdc1 A C 16: 13,854,393 probably null Het
Pkhd1l1 T C 15: 44,495,597 S401P probably damaging Het
Polr1a T C 6: 71,924,643 Y262H probably damaging Het
Scamp4 T C 10: 80,614,703 F205L probably benign Het
Scn1a C T 2: 66,324,755 S620N probably benign Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Slc17a8 T C 10: 89,606,734 D79G possibly damaging Het
Sync A G 4: 129,294,104 S310G probably benign Het
Tbc1d9b A C 11: 50,171,321 I1219L probably benign Het
Vmn1r47 T A 6: 90,022,675 M263K probably benign Het
Zfp773 A T 7: 7,132,692 C302S probably damaging Het
Other mutations in Cyr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cyr61 APN 3 145648610 missense probably damaging 0.96
IGL02500:Cyr61 APN 3 145648700 missense probably damaging 1.00
IGL02963:Cyr61 APN 3 145647875 missense probably damaging 1.00
IGL03170:Cyr61 APN 3 145649759 missense probably benign 0.01
R0018:Cyr61 UTSW 3 145649431 missense probably damaging 0.99
R0964:Cyr61 UTSW 3 145647748 missense probably damaging 1.00
R1234:Cyr61 UTSW 3 145649839 start gained probably benign
R1968:Cyr61 UTSW 3 145648210 missense probably damaging 0.99
R1989:Cyr61 UTSW 3 145647743 missense probably benign 0.31
R2071:Cyr61 UTSW 3 145648673 nonsense probably null
R5622:Cyr61 UTSW 3 145649320 missense probably damaging 1.00
R5639:Cyr61 UTSW 3 145648697 missense probably damaging 1.00
R5734:Cyr61 UTSW 3 145648268 missense probably damaging 1.00
R5792:Cyr61 UTSW 3 145648658 missense probably benign
R6129:Cyr61 UTSW 3 145649231 missense possibly damaging 0.85
R6689:Cyr61 UTSW 3 145647788 missense probably benign
R7131:Cyr61 UTSW 3 145648781 missense probably damaging 1.00
R7289:Cyr61 UTSW 3 145648673 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTACTCAAGAATGAGCAAGGCAC -3'
(R):5'- TCTTCCAGAAGGGCAAGAAATGCAG -3'

Sequencing Primer
(F):5'- TGAGCAAGGCACCATTCATC -3'
(R):5'- GCAAGAAATGCAGCAAGACC -3'
Posted On2013-10-16