Incidental Mutation 'R0848:Zfp619'
ID77421
Institutional Source Beutler Lab
Gene Symbol Zfp619
Ensembl Gene ENSMUSG00000068959
Gene Namezinc finger protein 619
Synonyms3000002G13Rik
MMRRC Submission 039027-MU
Accession Numbers

Genbank: NM_001004139; MGI: 1917477

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location39517766-39540420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39536559 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 671 (C671F)
Ref Sequence ENSEMBL: ENSMUSP00000103650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108015]
Predicted Effect probably damaging
Transcript: ENSMUST00000108015
AA Change: C671F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103650
Gene: ENSMUSG00000068959
AA Change: C671F

DomainStartEndE-ValueType
KRAB 4 61 2.19e-20 SMART
ZnF_C2H2 218 240 2.91e-2 SMART
ZnF_C2H2 246 268 5.81e-2 SMART
ZnF_C2H2 274 296 3.16e-3 SMART
ZnF_C2H2 302 324 2.4e-3 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 380 6.32e-3 SMART
ZnF_C2H2 386 408 8.47e-4 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 1.58e-3 SMART
ZnF_C2H2 470 492 5.42e-2 SMART
ZnF_C2H2 526 548 2.09e-3 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
ZnF_C2H2 582 604 1.56e-2 SMART
ZnF_C2H2 610 632 2.24e-3 SMART
ZnF_C2H2 638 660 4.72e-2 SMART
ZnF_C2H2 666 688 7.78e-3 SMART
ZnF_C2H2 694 716 5.9e-3 SMART
ZnF_C2H2 722 744 1.12e-3 SMART
ZnF_C2H2 748 770 6.42e-4 SMART
ZnF_C2H2 776 798 1.38e-3 SMART
ZnF_C2H2 804 826 9.44e-2 SMART
ZnF_C2H2 832 854 2.36e-2 SMART
ZnF_C2H2 860 882 8.94e-3 SMART
ZnF_C2H2 888 910 3.58e-2 SMART
ZnF_C2H2 916 938 6.42e-4 SMART
ZnF_C2H2 942 964 4.72e-2 SMART
ZnF_C2H2 970 992 2.3e-5 SMART
ZnF_C2H2 998 1020 8.34e-3 SMART
ZnF_C2H2 1026 1048 8.81e-2 SMART
ZnF_C2H2 1054 1076 1.69e-3 SMART
ZnF_C2H2 1082 1104 6.32e-3 SMART
ZnF_C2H2 1110 1132 1.47e-3 SMART
ZnF_C2H2 1138 1160 7.15e-2 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs), such as ZNF208, bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. A conserved protein motif, termed the Kruppel-associated box (KRAB) domain, mediates protein-protein interactions (Eichler et al., 1998 [PubMed 9724325]). See ZNF91 (MIM 603971) for further information on ZNFs.[supplied by OMIM, Aug 2009]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Other mutations in Zfp619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zfp619 APN 7 39534864 missense probably damaging 1.00
IGL02221:Zfp619 APN 7 39536910 missense probably benign 0.00
IGL02625:Zfp619 APN 7 39534185 splice site probably benign
3-1:Zfp619 UTSW 7 39536765 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0113:Zfp619 UTSW 7 39537759 missense probably benign 0.01
R0377:Zfp619 UTSW 7 39536797 nonsense probably null
R0614:Zfp619 UTSW 7 39537675 missense possibly damaging 0.79
R1157:Zfp619 UTSW 7 39536858 missense probably damaging 0.98
R2047:Zfp619 UTSW 7 39537638 missense probably damaging 0.99
R2074:Zfp619 UTSW 7 39534761 missense probably benign 0.00
R2419:Zfp619 UTSW 7 39535883 missense possibly damaging 0.71
R2571:Zfp619 UTSW 7 39537171 missense probably damaging 1.00
R2890:Zfp619 UTSW 7 39534969 missense probably benign 0.00
R3814:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4003:Zfp619 UTSW 7 39537306 missense possibly damaging 0.91
R4059:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4503:Zfp619 UTSW 7 39536856 missense probably damaging 1.00
R4664:Zfp619 UTSW 7 39534135 missense probably benign 0.00
R4696:Zfp619 UTSW 7 39536988 missense probably benign 0.00
R4895:Zfp619 UTSW 7 39537972 missense possibly damaging 0.68
R4975:Zfp619 UTSW 7 39537080 missense possibly damaging 0.90
R4977:Zfp619 UTSW 7 39537387 missense probably damaging 1.00
R5049:Zfp619 UTSW 7 39535514 missense probably benign 0.02
R5240:Zfp619 UTSW 7 39537218 missense possibly damaging 0.68
R5468:Zfp619 UTSW 7 39535728 missense unknown
R5546:Zfp619 UTSW 7 39535153 missense probably benign 0.01
R5572:Zfp619 UTSW 7 39535239 missense probably benign 0.01
R6106:Zfp619 UTSW 7 39535134 missense probably benign 0.01
R6329:Zfp619 UTSW 7 39537545 missense probably damaging 1.00
R6354:Zfp619 UTSW 7 39534819 missense probably benign 0.02
R6395:Zfp619 UTSW 7 39537030 missense possibly damaging 0.91
R6490:Zfp619 UTSW 7 39534162 missense probably benign 0.00
R6560:Zfp619 UTSW 7 39537530 missense probably damaging 1.00
R6713:Zfp619 UTSW 7 39537898 missense probably damaging 0.99
R7011:Zfp619 UTSW 7 39537762 missense probably damaging 1.00
R7022:Zfp619 UTSW 7 39534963 missense probably benign 0.00
R7046:Zfp619 UTSW 7 39537363 missense possibly damaging 0.95
R7206:Zfp619 UTSW 7 39535400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTTacacacacggacacaca -3'
(R):5'- CCGCAGGTTACTGAGGCTTTTGA -3'

Sequencing Primer
(F):5'- acggacacacacgggag -3'
(R):5'- TTTCGTGGACGCGAAGTA -3'
Posted On2013-10-16