Incidental Mutation 'R0848:Morf4l1'
ID77431
Institutional Source Beutler Lab
Gene Symbol Morf4l1
Ensembl Gene ENSMUSG00000062270
Gene Namemortality factor 4 like 1
SynonymsMRG15, Tex189, MORFRG15, TEG-189
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0848 (G1)
Quality Score102
Status Not validated
Chromosome9
Chromosomal Location90091665-90114774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90100449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 144 (V144A)
Ref Sequence ENSEMBL: ENSMUSP00000140023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085248] [ENSMUST00000169860] [ENSMUST00000190345] [ENSMUST00000191189] [ENSMUST00000191353]
Predicted Effect probably benign
Transcript: ENSMUST00000085248
AA Change: V145A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000082346
Gene: ENSMUSG00000062270
AA Change: V145A

DomainStartEndE-ValueType
Pfam:Tudor-knot 11 53 8.9e-11 PFAM
Blast:CHROMO 83 117 4e-6 BLAST
Pfam:MRG 174 348 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169860
AA Change: V106A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132020
Gene: ENSMUSG00000062270
AA Change: V106A

DomainStartEndE-ValueType
CHROMO 10 78 1.8e-9 SMART
Pfam:MRG 127 311 2.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189420
Predicted Effect probably benign
Transcript: ENSMUST00000190345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190377
Predicted Effect probably benign
Transcript: ENSMUST00000191189
SMART Domains Protein: ENSMUSP00000140118
Gene: ENSMUSG00000062270

DomainStartEndE-ValueType
CHROMO 10 78 1.1e-11 SMART
Pfam:MRG 100 284 1.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191353
AA Change: V144A

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140023
Gene: ENSMUSG00000062270
AA Change: V144A

DomainStartEndE-ValueType
Pfam:Tudor-knot 11 53 3.1e-8 PFAM
Blast:CHROMO 82 116 2e-6 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display perinatal lethality, cardiac hypertrophy, reduced alveolar space, decreased cell proliferation, congestion of the liver, lung, and spleen, skin edema, and thin skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Morf4l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Morf4l1 APN 9 90093795 missense probably benign 0.16
IGL03309:Morf4l1 APN 9 90103745 missense probably benign
R0893:Morf4l1 UTSW 9 90102350 missense probably damaging 1.00
R1155:Morf4l1 UTSW 9 90094504 missense probably benign 0.11
R1765:Morf4l1 UTSW 9 90102348 missense possibly damaging 0.60
R1972:Morf4l1 UTSW 9 90095214 unclassified probably benign
R3805:Morf4l1 UTSW 9 90095143 missense probably benign 0.10
R3806:Morf4l1 UTSW 9 90095143 missense probably benign 0.10
R3894:Morf4l1 UTSW 9 90094448 missense possibly damaging 0.90
R3895:Morf4l1 UTSW 9 90094448 missense possibly damaging 0.90
R5460:Morf4l1 UTSW 9 90095130 missense probably benign 0.10
R6884:Morf4l1 UTSW 9 90094479 missense probably damaging 1.00
R7088:Morf4l1 UTSW 9 90097380 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGGCATCTGAGAATCAAGACTTTCACTG -3'
(R):5'- GAGGGCAGCTCTTTTAAGGCATTTTAAC -3'

Sequencing Primer
(F):5'- CACTGACACTTTTAAAAGTGTCCA -3'
(R):5'- atccacctgcctctgcc -3'
Posted On2013-10-16