Incidental Mutation 'R0830:Cftr'
ID 77483
Institutional Source Beutler Lab
Gene Symbol Cftr
Ensembl Gene ENSMUSG00000041301
Gene Name cystic fibrosis transmembrane conductance regulator
Synonyms Abcc7
Accession Numbers
Essential gene? Probably non essential (E-score: 0.220) question?
Stock # R0830 (G1)
Quality Score 214
Status Not validated
Chromosome 6
Chromosomal Location 18170686-18322767 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18270224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 805 (I805V)
Ref Sequence ENSEMBL: ENSMUSP00000111065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000140407]
AlphaFold P26361
Predicted Effect probably benign
Transcript: ENSMUST00000045706
AA Change: I835V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: I835V

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.7e-40 PFAM
AAA 450 623 2.16e-12 SMART
Pfam:CFTR_R 639 844 2e-93 PFAM
Pfam:ABC_membrane 857 1142 2.7e-53 PFAM
AAA 1232 1414 9.94e-12 SMART
low complexity region 1465 1474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115405
SMART Domains Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.4e-48 PFAM
Pfam:ABC_tran 441 570 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115406
AA Change: I805V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: I805V

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 167 4e-14 PFAM
Pfam:ABC_membrane 162 320 2.5e-20 PFAM
AAA 420 593 2.16e-12 SMART
Pfam:CFTR_R 609 815 1.3e-97 PFAM
Pfam:ABC_membrane 827 1112 1e-50 PFAM
AAA 1202 1384 9.94e-12 SMART
low complexity region 1435 1444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140407
SMART Domains Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.2e-48 PFAM
Pfam:ABC_tran 441 568 6.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143135
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,765,624 (GRCm39) R145H probably damaging Het
Adam26a C T 8: 44,021,439 (GRCm39) V684I probably benign Het
Alk T C 17: 72,910,195 (GRCm39) I170M probably benign Het
Apc2 T C 10: 80,151,239 (GRCm39) Y2069H probably damaging Het
Aspm A G 1: 139,401,992 (GRCm39) T1219A probably damaging Het
Bnip1 T C 17: 27,008,679 (GRCm39) S94P probably benign Het
Col25a1 T A 3: 130,378,375 (GRCm39) D609E probably damaging Het
Cplane1 T A 15: 8,276,669 (GRCm39) V2771E unknown Het
Cyp2g1 A G 7: 26,514,216 (GRCm39) K274R probably benign Het
D5Ertd579e G A 5: 36,771,101 (GRCm39) T1098I probably damaging Het
Ddx39a T A 8: 84,446,452 (GRCm39) C74S possibly damaging Het
E2f3 C T 13: 30,169,543 (GRCm39) A37T probably benign Het
Emilin2 A G 17: 71,580,815 (GRCm39) M637T probably benign Het
Exosc7 T C 9: 122,948,358 (GRCm39) L93P probably benign Het
F2 T C 2: 91,460,545 (GRCm39) E316G probably benign Het
Fat4 A C 3: 39,053,258 (GRCm39) Q4084P probably benign Het
Flywch1 T C 17: 23,981,344 (GRCm39) K160E probably benign Het
Foxi2 A G 7: 135,013,459 (GRCm39) T230A probably benign Het
Fthl17a A G X: 84,313,679 (GRCm39) N154S possibly damaging Het
Hykk G A 9: 54,844,601 (GRCm39) R222Q probably damaging Het
Il18rap T A 1: 40,582,150 (GRCm39) V357E probably damaging Het
Ing4 A G 6: 125,020,923 (GRCm39) E15G probably damaging Het
Irak1 T C X: 73,060,189 (GRCm39) D679G probably damaging Het
Itga1 T C 13: 115,143,568 (GRCm39) E321G probably benign Het
Nudt1 T A 5: 140,321,076 (GRCm39) probably null Het
Nup58 A G 14: 60,480,931 (GRCm39) F138S probably damaging Het
Or10al6 A T 17: 38,082,804 (GRCm39) M87L probably damaging Het
Or2a5 G T 6: 42,873,532 (GRCm39) W49L probably benign Het
Pllp T C 8: 95,406,103 (GRCm39) Y60C probably damaging Het
Pnpla7 T C 2: 24,887,267 (GRCm39) V37A probably damaging Het
Poglut3 T G 9: 53,302,011 (GRCm39) L32R probably damaging Het
Psme4 A G 11: 30,757,797 (GRCm39) H310R possibly damaging Het
Rasl10b G A 11: 83,308,665 (GRCm39) probably null Het
Sash1 C T 10: 8,605,673 (GRCm39) V906M probably benign Het
Scn1a A T 2: 66,130,128 (GRCm39) I1212K probably damaging Het
Stbd1 A T 5: 92,752,989 (GRCm39) S160C probably benign Het
Tex29 T C 8: 11,904,157 (GRCm39) V99A probably benign Het
Tg A T 15: 66,596,993 (GRCm39) N79I probably damaging Het
Tie1 T C 4: 118,339,860 (GRCm39) D389G probably damaging Het
Vmn1r178 A G 7: 23,593,452 (GRCm39) T167A possibly damaging Het
Xkr4 C T 1: 3,740,968 (GRCm39) G202S possibly damaging Het
Other mutations in Cftr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cftr APN 6 18,268,429 (GRCm39) critical splice donor site probably null
IGL01082:Cftr APN 6 18,226,102 (GRCm39) missense probably damaging 0.97
IGL01113:Cftr APN 6 18,270,252 (GRCm39) missense probably damaging 1.00
IGL01383:Cftr APN 6 18,226,040 (GRCm39) missense probably benign 0.00
IGL01595:Cftr APN 6 18,198,238 (GRCm39) splice site probably benign
IGL01820:Cftr APN 6 18,226,138 (GRCm39) missense probably damaging 1.00
IGL02223:Cftr APN 6 18,221,481 (GRCm39) missense probably damaging 1.00
IGL02249:Cftr APN 6 18,277,870 (GRCm39) missense possibly damaging 0.58
IGL02439:Cftr APN 6 18,258,237 (GRCm39) nonsense probably null
IGL02537:Cftr APN 6 18,274,596 (GRCm39) missense probably benign 0.31
IGL03234:Cftr APN 6 18,225,987 (GRCm39) missense probably damaging 0.96
BB004:Cftr UTSW 6 18,267,970 (GRCm39) missense possibly damaging 0.81
BB014:Cftr UTSW 6 18,267,970 (GRCm39) missense possibly damaging 0.81
PIT4453001:Cftr UTSW 6 18,214,105 (GRCm39) missense probably damaging 0.99
PIT4520001:Cftr UTSW 6 18,277,842 (GRCm39) missense probably benign 0.01
R0114:Cftr UTSW 6 18,282,447 (GRCm39) missense probably damaging 1.00
R0329:Cftr UTSW 6 18,226,096 (GRCm39) missense probably null 1.00
R0330:Cftr UTSW 6 18,226,096 (GRCm39) missense probably null 1.00
R0331:Cftr UTSW 6 18,235,225 (GRCm39) missense possibly damaging 0.72
R0480:Cftr UTSW 6 18,274,517 (GRCm39) splice site probably benign
R0612:Cftr UTSW 6 18,198,125 (GRCm39) missense probably benign 0.01
R0633:Cftr UTSW 6 18,305,979 (GRCm39) missense probably damaging 0.99
R1559:Cftr UTSW 6 18,225,936 (GRCm39) missense probably benign 0.01
R1629:Cftr UTSW 6 18,226,105 (GRCm39) missense probably damaging 1.00
R1636:Cftr UTSW 6 18,226,156 (GRCm39) missense probably damaging 0.99
R1860:Cftr UTSW 6 18,268,288 (GRCm39) missense probably benign 0.00
R2043:Cftr UTSW 6 18,320,934 (GRCm39) missense probably benign
R2211:Cftr UTSW 6 18,214,279 (GRCm39) missense probably null 0.13
R4737:Cftr UTSW 6 18,299,882 (GRCm39) missense probably benign 0.19
R4793:Cftr UTSW 6 18,226,087 (GRCm39) missense probably damaging 1.00
R4857:Cftr UTSW 6 18,320,974 (GRCm39) missense possibly damaging 0.92
R4984:Cftr UTSW 6 18,235,198 (GRCm39) missense possibly damaging 0.89
R4999:Cftr UTSW 6 18,221,613 (GRCm39) missense probably benign 0.17
R5045:Cftr UTSW 6 18,230,080 (GRCm39) missense probably benign 0.20
R5183:Cftr UTSW 6 18,299,832 (GRCm39) missense probably damaging 0.99
R5197:Cftr UTSW 6 18,255,413 (GRCm39) missense probably benign 0.00
R5288:Cftr UTSW 6 18,226,128 (GRCm39) nonsense probably null
R5337:Cftr UTSW 6 18,319,058 (GRCm39) missense probably damaging 1.00
R5549:Cftr UTSW 6 18,227,953 (GRCm39) missense probably benign 0.00
R5596:Cftr UTSW 6 18,268,095 (GRCm39) missense probably benign 0.00
R5651:Cftr UTSW 6 18,255,364 (GRCm39) splice site probably null
R5660:Cftr UTSW 6 18,313,686 (GRCm39) missense probably benign 0.22
R5941:Cftr UTSW 6 18,313,645 (GRCm39) missense probably damaging 1.00
R6221:Cftr UTSW 6 18,282,500 (GRCm39) missense probably benign 0.00
R6222:Cftr UTSW 6 18,282,500 (GRCm39) missense probably benign 0.00
R6229:Cftr UTSW 6 18,220,683 (GRCm39) missense probably damaging 1.00
R6256:Cftr UTSW 6 18,274,660 (GRCm39) missense probably damaging 0.96
R6257:Cftr UTSW 6 18,282,500 (GRCm39) missense probably benign 0.00
R6412:Cftr UTSW 6 18,285,603 (GRCm39) missense probably damaging 0.97
R6459:Cftr UTSW 6 18,258,235 (GRCm39) missense probably damaging 1.00
R6558:Cftr UTSW 6 18,222,527 (GRCm39) missense probably damaging 1.00
R6724:Cftr UTSW 6 18,255,973 (GRCm39) nonsense probably null
R6787:Cftr UTSW 6 18,274,607 (GRCm39) nonsense probably null
R6861:Cftr UTSW 6 18,268,107 (GRCm39) missense probably benign 0.00
R6888:Cftr UTSW 6 18,313,729 (GRCm39) critical splice donor site probably null
R7084:Cftr UTSW 6 18,226,137 (GRCm39) missense probably benign 0.17
R7105:Cftr UTSW 6 18,318,971 (GRCm39) missense probably damaging 1.00
R7320:Cftr UTSW 6 18,319,012 (GRCm39) missense probably damaging 0.97
R7359:Cftr UTSW 6 18,221,623 (GRCm39) missense probably benign 0.00
R7466:Cftr UTSW 6 18,227,972 (GRCm39) missense probably benign
R7502:Cftr UTSW 6 18,214,295 (GRCm39) missense probably damaging 1.00
R7748:Cftr UTSW 6 18,277,888 (GRCm39) critical splice donor site probably null
R7808:Cftr UTSW 6 18,204,204 (GRCm39) missense probably benign
R7817:Cftr UTSW 6 18,267,967 (GRCm39) missense probably damaging 0.97
R7927:Cftr UTSW 6 18,267,970 (GRCm39) missense possibly damaging 0.81
R7968:Cftr UTSW 6 18,226,048 (GRCm39) missense probably benign 0.00
R7995:Cftr UTSW 6 18,214,155 (GRCm39) missense probably damaging 1.00
R8171:Cftr UTSW 6 18,258,287 (GRCm39) missense probably damaging 1.00
R8210:Cftr UTSW 6 18,220,696 (GRCm39) missense probably damaging 1.00
R8548:Cftr UTSW 6 18,273,698 (GRCm39) missense possibly damaging 0.87
R8712:Cftr UTSW 6 18,274,696 (GRCm39) missense probably damaging 0.99
R8737:Cftr UTSW 6 18,319,728 (GRCm39) missense probably damaging 1.00
R8926:Cftr UTSW 6 18,268,003 (GRCm39) missense possibly damaging 0.83
R8979:Cftr UTSW 6 18,227,947 (GRCm39) missense probably benign 0.10
R8996:Cftr UTSW 6 18,255,945 (GRCm39) nonsense probably null
R9087:Cftr UTSW 6 18,214,180 (GRCm39) missense possibly damaging 0.91
R9115:Cftr UTSW 6 18,235,310 (GRCm39) missense probably damaging 1.00
R9406:Cftr UTSW 6 18,299,866 (GRCm39) missense probably benign 0.00
R9689:Cftr UTSW 6 18,313,649 (GRCm39) missense probably damaging 0.99
R9700:Cftr UTSW 6 18,268,359 (GRCm39) missense probably damaging 1.00
R9747:Cftr UTSW 6 18,285,636 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CATGCTAAGGTTTGGGAAGTCTCACTG -3'
(R):5'- AGGAAACTACCGTTGTACACATGCAC -3'

Sequencing Primer
(F):5'- AGACATcctattctctgtggc -3'
(R):5'- CGTTGTACACATGCACATACAC -3'
Posted On 2013-10-16