Incidental Mutation 'R0831:Adgra3'
ID77531
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Nameadhesion G protein-coupled receptor A3
SynonymsGpr125, Tem5-like, 3830613O22Rik
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0831 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location49959956-50059006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49970802 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 779 (I779N)
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971]
Predicted Effect probably damaging
Transcript: ENSMUST00000030971
AA Change: I779N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: I779N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196177
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Afg3l2 A C 18: 67,421,227 F468L probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Col6a2 A T 10: 76,604,105 N655K probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Dnajc13 C A 9: 104,172,612 G1765V probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Dpp8 A T 9: 65,078,679 N817I possibly damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr273 T G 4: 52,855,764 I250L possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sdk2 A T 11: 113,832,258 D1302E probably damaging Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slc4a9 T C 18: 36,535,278 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Zc3h7a A G 16: 11,151,880 S386P probably damaging Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50025758 missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50001949 missense probably damaging 1.00
IGL01455:Adgra3 APN 5 49987557 nonsense probably null
IGL01665:Adgra3 APN 5 50006930 missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 49979142 missense probably benign
IGL02239:Adgra3 APN 5 49960712 missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02358:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02938:Adgra3 APN 5 49961317 missense probably benign 0.01
IGL03028:Adgra3 APN 5 50016852 missense probably benign 0.30
aperture UTSW 5 49999145 nonsense probably null
saltatory UTSW 5 49960559 missense probably benign 0.09
ANU74:Adgra3 UTSW 5 49961038 missense probably benign 0.16
R0041:Adgra3 UTSW 5 49960559 missense probably benign 0.09
R0121:Adgra3 UTSW 5 50025786 splice site probably benign
R0125:Adgra3 UTSW 5 50001852 splice site probably benign
R0137:Adgra3 UTSW 5 49963840 splice site probably benign
R0415:Adgra3 UTSW 5 49961757 splice site probably benign
R0479:Adgra3 UTSW 5 49990265 missense probably benign 0.00
R0505:Adgra3 UTSW 5 50009334 critical splice donor site probably null
R0883:Adgra3 UTSW 5 49960723 missense probably damaging 1.00
R0920:Adgra3 UTSW 5 49961161 missense probably benign 0.19
R1139:Adgra3 UTSW 5 49961755 splice site probably null
R1211:Adgra3 UTSW 5 50006876 missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 49960787 missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 49961137 missense probably benign 0.00
R1703:Adgra3 UTSW 5 50006775 missense probably benign 0.00
R1782:Adgra3 UTSW 5 49972062 missense probably benign 0.02
R1843:Adgra3 UTSW 5 49961492 missense probably damaging 1.00
R2157:Adgra3 UTSW 5 50001941 missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50001880 missense probably benign 0.04
R2385:Adgra3 UTSW 5 49979566 missense possibly damaging 0.95
R2426:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R3084:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3086:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3409:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R4301:Adgra3 UTSW 5 49961078 missense possibly damaging 0.94
R4360:Adgra3 UTSW 5 49990210 missense possibly damaging 0.92
R4475:Adgra3 UTSW 5 50001898 missense probably damaging 1.00
R4569:Adgra3 UTSW 5 49960563 missense probably damaging 1.00
R4607:Adgra3 UTSW 5 49970739 missense probably damaging 0.98
R4667:Adgra3 UTSW 5 49978956 missense possibly damaging 0.94
R4671:Adgra3 UTSW 5 49979368 missense probably damaging 1.00
R4886:Adgra3 UTSW 5 49999195 missense probably benign 0.07
R5197:Adgra3 UTSW 5 49960754 missense probably benign 0.01
R5208:Adgra3 UTSW 5 50011515 missense probably damaging 0.99
R5313:Adgra3 UTSW 5 49961309 missense probably benign 0.24
R5435:Adgra3 UTSW 5 49990126 missense probably damaging 0.99
R5663:Adgra3 UTSW 5 49999285 missense probably benign 0.14
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6064:Adgra3 UTSW 5 49960325 missense probably damaging 0.97
R6259:Adgra3 UTSW 5 49999141 missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R6293:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6296:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6297:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6352:Adgra3 UTSW 5 49979136 missense probably benign
R6352:Adgra3 UTSW 5 49990250 missense probably benign 0.01
R6989:Adgra3 UTSW 5 50006884 missense probably damaging 1.00
X0065:Adgra3 UTSW 5 49971962 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTGAGACTGCTTAGTGGACAGG -3'
(R):5'- GCCACGCATGTAATTCAGGCTTC -3'

Sequencing Primer
(F):5'- TTAGTGGACAGGCACTGGG -3'
(R):5'- GCATGTAATTCAGGCTTCTTCAAC -3'
Posted On2013-10-16