Incidental Mutation 'R0831:Dpp8'
ID77552
Institutional Source Beutler Lab
Gene Symbol Dpp8
Ensembl Gene ENSMUSG00000032393
Gene Namedipeptidylpeptidase 8
Synonyms2310004I03Rik, 4932434F09Rik
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R0831 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65032414-65082651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65078679 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 817 (N817I)
Ref Sequence ENSEMBL: ENSMUSP00000126065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034960] [ENSMUST00000167773] [ENSMUST00000217434]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034960
AA Change: N817I

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034960
Gene: ENSMUSG00000032393
AA Change: N817I

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 1e-100 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 671 860 4.8e-9 PFAM
Pfam:Peptidase_S9 676 885 6.5e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167773
AA Change: N817I

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126065
Gene: ENSMUSG00000032393
AA Change: N817I

DomainStartEndE-ValueType
low complexity region 144 154 N/A INTRINSIC
Pfam:DPPIV_N 168 589 3.3e-102 PFAM
Pfam:Peptidase_S15 636 830 7.3e-11 PFAM
Pfam:Abhydrolase_5 670 860 6.5e-9 PFAM
Pfam:Peptidase_S9 677 885 8.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217328
Predicted Effect probably benign
Transcript: ENSMUST00000217434
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S9B family, a small family of dipeptidyl peptidases that are able to cleave peptide substrates at a prolyl bond. The encoded protein shares similarity with dipeptidyl peptidase IV in that it is ubiquitously expressed, and hydrolyzes the same substrates. These similarities suggest that, like dipeptidyl peptidase IV, this protein may play a role in T-cell activation and immune function. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgra3 A T 5: 49,970,802 I779N probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Afg3l2 A C 18: 67,421,227 F468L probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Col6a2 A T 10: 76,604,105 N655K probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Dnajc13 C A 9: 104,172,612 G1765V probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr273 T G 4: 52,855,764 I250L possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sdk2 A T 11: 113,832,258 D1302E probably damaging Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slc4a9 T C 18: 36,535,278 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Zc3h7a A G 16: 11,151,880 S386P probably damaging Het
Other mutations in Dpp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Dpp8 APN 9 65078008 missense probably damaging 1.00
IGL00576:Dpp8 APN 9 65043829 missense probably benign 0.32
IGL01303:Dpp8 APN 9 65055012 splice site probably benign
IGL01506:Dpp8 APN 9 65063417 splice site probably benign
IGL01544:Dpp8 APN 9 65054988 missense probably benign 0.05
IGL02387:Dpp8 APN 9 65045716 missense probably damaging 1.00
IGL02567:Dpp8 APN 9 65078776 nonsense probably null
IGL02611:Dpp8 APN 9 65055793 missense probably benign 0.15
IGL02723:Dpp8 APN 9 65042267 missense possibly damaging 0.91
IGL02927:Dpp8 APN 9 65060269 missense probably benign 0.09
IGL03116:Dpp8 APN 9 65066467 missense probably damaging 0.96
IGL03135:Dpp8 APN 9 65053040 splice site probably null
IGL03356:Dpp8 APN 9 65045787 missense probably benign 0.00
IGL03050:Dpp8 UTSW 9 65054836 missense probably benign 0.00
R0498:Dpp8 UTSW 9 65045795 splice site probably benign
R0594:Dpp8 UTSW 9 65036998 missense probably damaging 1.00
R0675:Dpp8 UTSW 9 65066502 splice site probably benign
R0699:Dpp8 UTSW 9 65054894 missense probably benign 0.01
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1148:Dpp8 UTSW 9 65053832 critical splice donor site probably null
R1512:Dpp8 UTSW 9 65063814 splice site probably benign
R1515:Dpp8 UTSW 9 65078748 missense probably benign 0.04
R1546:Dpp8 UTSW 9 65063493 missense possibly damaging 0.76
R1556:Dpp8 UTSW 9 65051479 missense probably damaging 1.00
R2027:Dpp8 UTSW 9 65078774 missense probably damaging 1.00
R2104:Dpp8 UTSW 9 65074567 synonymous probably null
R2113:Dpp8 UTSW 9 65063868 missense probably benign 0.00
R2656:Dpp8 UTSW 9 65080804 missense probably damaging 1.00
R4237:Dpp8 UTSW 9 65054923 missense probably benign
R4238:Dpp8 UTSW 9 65054923 missense probably benign
R4239:Dpp8 UTSW 9 65054923 missense probably benign
R4595:Dpp8 UTSW 9 65075803 missense probably damaging 1.00
R4614:Dpp8 UTSW 9 65066396 missense probably benign 0.00
R4946:Dpp8 UTSW 9 65055918 missense probably benign 0.00
R5338:Dpp8 UTSW 9 65063924 nonsense probably null
R5378:Dpp8 UTSW 9 65078014 missense probably damaging 1.00
R5506:Dpp8 UTSW 9 65078109 splice site probably null
R5644:Dpp8 UTSW 9 65045735 nonsense probably null
R5862:Dpp8 UTSW 9 65045722 missense probably benign 0.03
R6437:Dpp8 UTSW 9 65074578 missense probably benign 0.01
R6783:Dpp8 UTSW 9 65063562 missense possibly damaging 0.76
R6863:Dpp8 UTSW 9 65035008 missense probably damaging 0.98
R7192:Dpp8 UTSW 9 65045786 missense possibly damaging 0.70
R7461:Dpp8 UTSW 9 65053120 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAGAGTGGAAGCAAGTCTGTCAGC -3'
(R):5'- GTGCAGACACAGCTAGACACTCAG -3'

Sequencing Primer
(F):5'- AAGCAAGTCTGTCAGCTTAGTG -3'
(R):5'- AGCTAGACACTCAGCCTTGTTC -3'
Posted On2013-10-16