Incidental Mutation 'R0833:Fryl'
ID77623
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene NameFRY like transcription coactivator
Synonyms2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission 039012-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R0833 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73019987-73256619 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 73089081 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
Predicted Effect probably benign
Transcript: ENSMUST00000094700
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101127
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202381
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (97/97)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
Aldh1a7 C T 19: 20,702,243 V390M probably damaging Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Arl2 T G 19: 6,136,022 K126T probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Astl T C 2: 127,342,419 F21L probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbwd1 A G 19: 24,940,839 probably benign Het
Ccdc144b A G 3: 36,020,213 probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fam219b A G 9: 57,538,016 probably benign Het
Gm12800 G A 4: 101,910,097 C181Y probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm14496 T C 2: 181,996,266 W378R probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm8674 A T 13: 49,904,575 noncoding transcript Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Grk2 C A 19: 4,289,357 L428F probably damaging Het
Grm8 T A 6: 27,363,179 E779V probably damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc45 T A 11: 120,718,193 probably null Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Meis1 G A 11: 18,881,767 H424Y possibly damaging Het
Mst1r G A 9: 107,913,167 V660I probably benign Het
Mst1r A G 9: 107,914,776 N837S probably benign Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr578 C A 7: 102,984,836 L109F possibly damaging Het
Olfr875 T C 9: 37,773,076 V139A probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Syvn1 C T 19: 6,052,453 P517L probably benign Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Ucp3 T A 7: 100,479,541 C25* probably null Het
Ugt3a2 A G 15: 9,370,150 D460G probably damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Ush1g G T 11: 115,318,868 R167S possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTTCGGTCCCTAAACAAGGCTACC -3'
(R):5'- TAGGCGTATCCAGAAGCAGCTTCCTC -3'

Sequencing Primer
(F):5'- GACAGAAAGCACTCTTAGCG -3'
(R):5'- GGAACCGGAAGTAACTCTTGTCTAC -3'
Posted On2013-10-16