Incidental Mutation 'R0833:Dnah11'
ID77666
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Namedynein, axonemal, heavy chain 11
Synonymsb2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo
MMRRC Submission 039012-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R0833 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location117877982-118199043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118196662 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 111 (A111V)
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
Predicted Effect probably benign
Transcript: ENSMUST00000084806
AA Change: A111V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: A111V

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
Aldh1a7 C T 19: 20,702,243 V390M probably damaging Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Arl2 T G 19: 6,136,022 K126T probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Astl T C 2: 127,342,419 F21L probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbwd1 A G 19: 24,940,839 probably benign Het
Ccdc144b A G 3: 36,020,213 probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fam219b A G 9: 57,538,016 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Gm12800 G A 4: 101,910,097 C181Y probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm14496 T C 2: 181,996,266 W378R probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm8674 A T 13: 49,904,575 noncoding transcript Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Grk2 C A 19: 4,289,357 L428F probably damaging Het
Grm8 T A 6: 27,363,179 E779V probably damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc45 T A 11: 120,718,193 probably null Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Meis1 G A 11: 18,881,767 H424Y possibly damaging Het
Mst1r G A 9: 107,913,167 V660I probably benign Het
Mst1r A G 9: 107,914,776 N837S probably benign Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr578 C A 7: 102,984,836 L109F possibly damaging Het
Olfr875 T C 9: 37,773,076 V139A probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Syvn1 C T 19: 6,052,453 P517L probably benign Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Ucp3 T A 7: 100,479,541 C25* probably null Het
Ugt3a2 A G 15: 9,370,150 D460G probably damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Ush1g G T 11: 115,318,868 R167S possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118198745 missense probably benign 0.28
IGL00422:Dnah11 APN 12 118068096 missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118036459 missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118186922 missense probably benign 0.01
IGL00687:Dnah11 APN 12 117922004 splice site probably benign
IGL00833:Dnah11 APN 12 118179580 missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117911202 missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118196651 missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118142934 splice site probably benign
IGL01121:Dnah11 APN 12 118050695 missense probably benign 0.02
IGL01143:Dnah11 APN 12 118012740 missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117982999 missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118192399 missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118047256 nonsense probably null
IGL01418:Dnah11 APN 12 117987482 nonsense probably null
IGL01444:Dnah11 APN 12 118020232 missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117983032 missense probably benign 0.15
IGL01645:Dnah11 APN 12 118186998 missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118192270 splice site probably benign
IGL02104:Dnah11 APN 12 118192390 missense probably benign
IGL02151:Dnah11 APN 12 118059888 splice site probably benign
IGL02189:Dnah11 APN 12 118082579 missense probably benign 0.00
IGL02417:Dnah11 APN 12 118057180 missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118186902 missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117975873 splice site probably benign
IGL02474:Dnah11 APN 12 118027445 splice site probably null
IGL02526:Dnah11 APN 12 118179618 missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117911040 missense probably damaging 1.00
IGL03011:Dnah11 APN 12 118012377 missense probably benign 0.08
IGL03061:Dnah11 APN 12 117903121 missense probably damaging 1.00
IGL03182:Dnah11 APN 12 118030291 missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118105985 missense probably benign
IGL03238:Dnah11 APN 12 118109898 missense probably damaging 1.00
IGL03493:Dnah11 APN 12 118012798 missense probably benign 0.00
P0045:Dnah11 UTSW 12 118030327 missense probably benign
R0009:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118126886 missense probably benign 0.05
R0172:Dnah11 UTSW 12 117987453 missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117983056 nonsense probably null
R0270:Dnah11 UTSW 12 118041013 missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118127133 missense probably benign 0.03
R0325:Dnah11 UTSW 12 118012339 missense probably benign
R0370:Dnah11 UTSW 12 117995227 missense probably benign
R0416:Dnah11 UTSW 12 117911058 missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118106510 missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117931178 missense probably benign 0.01
R0607:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117987469 missense probably damaging 1.00
R0635:Dnah11 UTSW 12 118007996 missense probably damaging 1.00
R0755:Dnah11 UTSW 12 117954829 missense possibly damaging 0.95
R0755:Dnah11 UTSW 12 118198625 missense probably benign 0.17
R0789:Dnah11 UTSW 12 117911232 missense probably damaging 1.00
R0835:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0846:Dnah11 UTSW 12 117933850 missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118190844 nonsense probably null
R0928:Dnah11 UTSW 12 118045562 missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118060407 missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117933812 missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117972364 missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118057106 nonsense probably null
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1500:Dnah11 UTSW 12 118012829 synonymous probably null
R1535:Dnah11 UTSW 12 118018730 missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117931256 missense probably benign 0.01
R1554:Dnah11 UTSW 12 118082499 missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R1618:Dnah11 UTSW 12 118015465 missense probably damaging 0.98
R1638:Dnah11 UTSW 12 118015419 missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118120724 missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117933845 missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118190868 missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118196644 missense probably benign 0.32
R1728:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118190825 missense probably benign 0.31
R1780:Dnah11 UTSW 12 118027558 missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118038780 missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118063852 missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118127556 missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118082468 missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118113871 missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 118012716 missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 118020353 missense probably damaging 1.00
R2140:Dnah11 UTSW 12 118008810 missense probably benign 0.01
R2261:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2261:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2262:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2263:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117886686 missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117928330 missense probably damaging 1.00
R2410:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117987427 nonsense probably null
R3499:Dnah11 UTSW 12 117911023 missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3742:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3779:Dnah11 UTSW 12 118130713 splice site probably benign
R3785:Dnah11 UTSW 12 118017602 missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117978453 splice site probably benign
R4014:Dnah11 UTSW 12 117974914 missense probably benign 0.16
R4043:Dnah11 UTSW 12 117879943 missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118106492 missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4074:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4076:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4201:Dnah11 UTSW 12 117966659 missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118130892 missense probably benign 0.06
R4233:Dnah11 UTSW 12 117916791 missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118125843 nonsense probably null
R4430:Dnah11 UTSW 12 117983011 missense probably benign 0.26
R4465:Dnah11 UTSW 12 117987451 missense probably benign 0.09
R4489:Dnah11 UTSW 12 117916896 missense probably benign 0.31
R4572:Dnah11 UTSW 12 118010125 missense probably benign 0.00
R4574:Dnah11 UTSW 12 118012255 critical splice donor site probably null
R4657:Dnah11 UTSW 12 118192427 missense probably benign 0.02
R4709:Dnah11 UTSW 12 118018760 missense probably benign 0.26
R4740:Dnah11 UTSW 12 118120544 missense probably benign 0.28
R4803:Dnah11 UTSW 12 118127608 missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117995200 missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118126883 missense probably benign 0.37
R5018:Dnah11 UTSW 12 118130728 missense probably benign 0.00
R5071:Dnah11 UTSW 12 118082453 nonsense probably null
R5074:Dnah11 UTSW 12 118082453 nonsense probably null
R5080:Dnah11 UTSW 12 118198830 start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 118017700 missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117954751 missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118157361 missense probably benign 0.09
R5252:Dnah11 UTSW 12 118125941 missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117883416 missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118085680 missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117954893 missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118085697 missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117880451 critical splice donor site probably null
R5546:Dnah11 UTSW 12 117975848 missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 118018802 missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117883617 missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118113907 missense probably benign 0.04
R5706:Dnah11 UTSW 12 118023935 missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118127106 missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118192390 missense probably benign
R5884:Dnah11 UTSW 12 118177534 missense probably benign 0.00
R5900:Dnah11 UTSW 12 118082431 splice site probably null
R5905:Dnah11 UTSW 12 117954924 missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117914636 splice site probably null
R5973:Dnah11 UTSW 12 118110952 missense probably benign 0.02
R6024:Dnah11 UTSW 12 118030272 missense probably benign 0.34
R6056:Dnah11 UTSW 12 117928456 missense probably benign 0.03
R6075:Dnah11 UTSW 12 118104851 missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117928456 missense probably benign
R6191:Dnah11 UTSW 12 118190897 missense probably benign
R6197:Dnah11 UTSW 12 118179747 missense probably benign 0.03
R6262:Dnah11 UTSW 12 117931178 missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117916855 missense probably benign 0.01
R6614:Dnah11 UTSW 12 117886676 missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118186882 splice site probably null
R6712:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118045646 missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118113894 missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117987676 intron probably null
R6895:Dnah11 UTSW 12 117995191 missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118106562 missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118198768 missense probably benign
R6945:Dnah11 UTSW 12 118060310 missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117933809 missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118108944 missense probably benign 0.00
R6976:Dnah11 UTSW 12 118198643 missense probably benign 0.16
Z1088:Dnah11 UTSW 12 117895012 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117982969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGTGGCTCAACCAGTACCAG -3'
(R):5'- CTTTGCCTTGACAGCAGGAATGC -3'

Sequencing Primer
(F):5'- GGTGTCTGGAGGTCAAGAAAG -3'
(R):5'- GCAACAGAGCAACCTTGTTTG -3'
Posted On2013-10-16