Incidental Mutation 'R0834:Dhcr7'
ID77730
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 039013-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0834 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143823145-143848410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143841227 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 157 (N157S)
Ref Sequence ENSEMBL: ENSMUSP00000119984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000125564] [ENSMUST00000128454] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000144034] [ENSMUST00000145471] [ENSMUST00000207143]
Predicted Effect probably benign
Transcript: ENSMUST00000073878
AA Change: N157S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: N157S

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124340
AA Change: N157S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: N157S

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125564
Predicted Effect probably benign
Transcript: ENSMUST00000128454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably benign
Transcript: ENSMUST00000141916
AA Change: N157S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: N157S

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
AA Change: N157S

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454
AA Change: N157S

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144034
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably benign
Transcript: ENSMUST00000207143
AA Change: N160S

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208631
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T C 16: 14,093,931 L47P probably damaging Het
Add2 A T 6: 86,086,917 E66V probably damaging Het
Aldh1a3 T C 7: 66,412,910 I156V probably benign Het
Ang4 T A 14: 51,764,268 K74N probably benign Het
Arcn1 A T 9: 44,758,875 probably benign Het
Arhgef33 T A 17: 80,347,597 probably benign Het
Arntl2 A G 6: 146,822,687 H359R probably damaging Het
Atn1 A G 6: 124,743,225 probably benign Het
Brip1 T C 11: 86,192,827 T123A probably benign Het
Camkv A G 9: 107,945,846 Y95C probably damaging Het
Cdk12 T A 11: 98,204,385 S340T probably benign Het
Ckap2l G A 2: 129,296,304 probably benign Het
Clmn A T 12: 104,771,826 L1042Q probably damaging Het
Clmn G T 12: 104,771,827 L1042M probably damaging Het
Cluh T C 11: 74,663,805 V737A probably benign Het
Cpne8 A G 15: 90,540,259 V309A probably benign Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Csmd3 A T 15: 47,883,677 probably benign Het
Ctr9 T A 7: 111,050,952 S818T probably benign Het
Cyp26a1 C T 19: 37,699,957 A309V probably damaging Het
D10Jhu81e T C 10: 78,162,705 D229G probably damaging Het
Dbndd2 C T 2: 164,490,202 T115I possibly damaging Het
Ddx58 T A 4: 40,239,596 E34V possibly damaging Het
Dlx2 C A 2: 71,545,515 V155F probably damaging Het
Duox1 A T 2: 122,346,501 I1470F probably damaging Het
Esrrb A T 12: 86,470,297 I68F probably benign Het
Fhod3 T A 18: 25,115,805 L1347* probably null Het
Fip1l1 T C 5: 74,595,060 probably benign Het
Frem3 A G 8: 80,687,008 Y1966C probably damaging Het
Ggt5 C T 10: 75,604,770 R242C possibly damaging Het
Gm14496 G A 2: 181,995,687 V185I probably benign Het
Gnptab T C 10: 88,429,952 V409A probably damaging Het
Gramd1a A G 7: 31,138,164 F390S possibly damaging Het
Helz2 A G 2: 181,230,777 S2477P probably damaging Het
Hsd17b3 T C 13: 64,089,122 K3E probably benign Het
Ift172 T C 5: 31,257,371 H1395R probably benign Het
Jam2 T A 16: 84,812,967 C180S probably damaging Het
Kalrn A C 16: 34,049,919 S160A possibly damaging Het
Kcnk3 T C 5: 30,622,635 I343T probably damaging Het
Kif13a T C 13: 46,814,236 E334G probably damaging Het
Klhl41 A G 2: 69,678,147 K482E possibly damaging Het
Lig3 A G 11: 82,798,287 E794G probably damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Ndst2 A G 14: 20,729,693 Y160H probably damaging Het
Ndufb10 T C 17: 24,722,674 M90V probably damaging Het
Obscn T C 11: 59,133,278 K522R probably benign Het
Olfml2b T C 1: 170,647,844 S113P probably benign Het
Olfr1251 A G 2: 89,667,079 I269T probably benign Het
Olfr1424 T A 19: 12,059,615 M46L probably benign Het
Olfr298 T A 7: 86,489,490 E20D probably benign Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr620 T C 7: 103,612,237 T39A probably benign Het
Parg T C 14: 32,214,554 probably benign Het
Pde7a C T 3: 19,230,318 C367Y probably damaging Het
Pigr T A 1: 130,844,544 C166* probably null Het
Pip4k2c A T 10: 127,200,835 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkd2 A T 7: 16,865,677 probably benign Het
Ptprt G T 2: 161,812,139 probably null Het
Rapgef5 C T 12: 117,647,121 probably benign Het
Retreg1 T C 15: 25,971,670 L356P probably benign Het
Rnf43 A G 11: 87,731,251 T393A probably benign Het
Samd3 T C 10: 26,271,827 S467P probably benign Het
Scarf1 C A 11: 75,514,403 C89* probably null Het
Sdk1 T C 5: 141,242,024 L59S probably benign Het
Sgca C T 11: 94,970,686 W244* probably null Het
Sh3d21 T C 4: 126,151,272 K538R probably benign Het
Smyd4 T A 11: 75,391,132 L477Q possibly damaging Het
Sra1 A G 18: 36,668,776 M87T probably benign Het
Ssh2 T C 11: 77,437,633 Y336H possibly damaging Het
Steap1 T C 5: 5,740,357 Y197C probably damaging Het
Strn3 A G 12: 51,627,096 probably benign Het
Tgm3 A G 2: 130,026,757 T205A probably benign Het
Tll2 G A 19: 41,113,073 T374I probably damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Trim10 G A 17: 36,872,391 S193N probably benign Het
Ttf1 A T 2: 29,073,950 K613* probably null Het
Tube1 T A 10: 39,134,172 probably null Het
Uimc1 T A 13: 55,076,409 probably null Het
Wwp2 G T 8: 107,556,796 probably benign Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp292 T C 4: 34,809,114 D1310G probably benign Het
Zfp575 A T 7: 24,585,820 L132H probably damaging Het
Zmym2 T C 14: 56,956,963 F1226S probably damaging Het
Zswim6 A C 13: 107,726,454 noncoding transcript Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143847068 missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143841319 missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143843311 missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143845499 missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143843128 missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143847366 missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143840497 missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143837770 missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143840463 missense possibly damaging 0.92
R1473:Dhcr7 UTSW 7 143841368 missense probably damaging 1.00
R1473:Dhcr7 UTSW 7 143847068 missense probably damaging 0.99
R1769:Dhcr7 UTSW 7 143847513 missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143847458 missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143847430 missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143837892 missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143841173 missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143843227 missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143837917 missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143837791 missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143841323 missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143837839 missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143847423 missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143836731 critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143843311 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTGCTACTAGCCTTTAAGCCTG -3'
(R):5'- GCCCAGATGCTAAGGAACTTACCAG -3'

Sequencing Primer
(F):5'- AATGACCCCTGTCCTTCAGAATG -3'
(R):5'- GCTAAGGAACTTACCAGTCTTCG -3'
Posted On2013-10-16