Incidental Mutation 'R0834:Strn3'
ID77751
Institutional Source Beutler Lab
Gene Symbol Strn3
Ensembl Gene ENSMUSG00000020954
Gene Namestriatin, calmodulin binding protein 3
SynonymsSG2NA
MMRRC Submission 039013-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R0834 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51609632-51691897 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 51627096 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013130] [ENSMUST00000169503]
Predicted Effect probably benign
Transcript: ENSMUST00000013130
SMART Domains Protein: ENSMUSP00000013130
Gene: ENSMUSG00000020954

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 194 1.3e-50 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
WD40 468 507 7.05e-9 SMART
WD40 521 560 2.42e-7 SMART
WD40 574 613 1.62e-8 SMART
WD40 617 659 8.25e0 SMART
WD40 670 708 2.65e1 SMART
WD40 711 750 2.32e-9 SMART
WD40 753 796 4.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169503
SMART Domains Protein: ENSMUSP00000130184
Gene: ENSMUSG00000020954

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 198 3.2e-51 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
WD40 384 423 7.05e-9 SMART
WD40 437 476 2.42e-7 SMART
WD40 490 529 1.62e-8 SMART
WD40 533 575 8.25e0 SMART
WD40 586 624 2.65e1 SMART
WD40 627 666 2.32e-9 SMART
WD40 669 712 4.95e-4 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T C 16: 14,093,931 L47P probably damaging Het
Add2 A T 6: 86,086,917 E66V probably damaging Het
Aldh1a3 T C 7: 66,412,910 I156V probably benign Het
Ang4 T A 14: 51,764,268 K74N probably benign Het
Arcn1 A T 9: 44,758,875 probably benign Het
Arhgef33 T A 17: 80,347,597 probably benign Het
Arntl2 A G 6: 146,822,687 H359R probably damaging Het
Atn1 A G 6: 124,743,225 probably benign Het
Brip1 T C 11: 86,192,827 T123A probably benign Het
Camkv A G 9: 107,945,846 Y95C probably damaging Het
Cdk12 T A 11: 98,204,385 S340T probably benign Het
Ckap2l G A 2: 129,296,304 probably benign Het
Clmn A T 12: 104,771,826 L1042Q probably damaging Het
Clmn G T 12: 104,771,827 L1042M probably damaging Het
Cluh T C 11: 74,663,805 V737A probably benign Het
Cpne8 A G 15: 90,540,259 V309A probably benign Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Csmd3 A T 15: 47,883,677 probably benign Het
Ctr9 T A 7: 111,050,952 S818T probably benign Het
Cyp26a1 C T 19: 37,699,957 A309V probably damaging Het
D10Jhu81e T C 10: 78,162,705 D229G probably damaging Het
Dbndd2 C T 2: 164,490,202 T115I possibly damaging Het
Ddx58 T A 4: 40,239,596 E34V possibly damaging Het
Dhcr7 A G 7: 143,841,227 N157S probably benign Het
Dlx2 C A 2: 71,545,515 V155F probably damaging Het
Duox1 A T 2: 122,346,501 I1470F probably damaging Het
Esrrb A T 12: 86,470,297 I68F probably benign Het
Fhod3 T A 18: 25,115,805 L1347* probably null Het
Fip1l1 T C 5: 74,595,060 probably benign Het
Frem3 A G 8: 80,687,008 Y1966C probably damaging Het
Ggt5 C T 10: 75,604,770 R242C possibly damaging Het
Gm14496 G A 2: 181,995,687 V185I probably benign Het
Gnptab T C 10: 88,429,952 V409A probably damaging Het
Gramd1a A G 7: 31,138,164 F390S possibly damaging Het
Helz2 A G 2: 181,230,777 S2477P probably damaging Het
Hsd17b3 T C 13: 64,089,122 K3E probably benign Het
Ift172 T C 5: 31,257,371 H1395R probably benign Het
Jam2 T A 16: 84,812,967 C180S probably damaging Het
Kalrn A C 16: 34,049,919 S160A possibly damaging Het
Kcnk3 T C 5: 30,622,635 I343T probably damaging Het
Kif13a T C 13: 46,814,236 E334G probably damaging Het
Klhl41 A G 2: 69,678,147 K482E possibly damaging Het
Lig3 A G 11: 82,798,287 E794G probably damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Ndst2 A G 14: 20,729,693 Y160H probably damaging Het
Ndufb10 T C 17: 24,722,674 M90V probably damaging Het
Obscn T C 11: 59,133,278 K522R probably benign Het
Olfml2b T C 1: 170,647,844 S113P probably benign Het
Olfr1251 A G 2: 89,667,079 I269T probably benign Het
Olfr1424 T A 19: 12,059,615 M46L probably benign Het
Olfr298 T A 7: 86,489,490 E20D probably benign Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr620 T C 7: 103,612,237 T39A probably benign Het
Parg T C 14: 32,214,554 probably benign Het
Pde7a C T 3: 19,230,318 C367Y probably damaging Het
Pigr T A 1: 130,844,544 C166* probably null Het
Pip4k2c A T 10: 127,200,835 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkd2 A T 7: 16,865,677 probably benign Het
Ptprt G T 2: 161,812,139 probably null Het
Rapgef5 C T 12: 117,647,121 probably benign Het
Retreg1 T C 15: 25,971,670 L356P probably benign Het
Rnf43 A G 11: 87,731,251 T393A probably benign Het
Samd3 T C 10: 26,271,827 S467P probably benign Het
Scarf1 C A 11: 75,514,403 C89* probably null Het
Sdk1 T C 5: 141,242,024 L59S probably benign Het
Sgca C T 11: 94,970,686 W244* probably null Het
Sh3d21 T C 4: 126,151,272 K538R probably benign Het
Smyd4 T A 11: 75,391,132 L477Q possibly damaging Het
Sra1 A G 18: 36,668,776 M87T probably benign Het
Ssh2 T C 11: 77,437,633 Y336H possibly damaging Het
Steap1 T C 5: 5,740,357 Y197C probably damaging Het
Tgm3 A G 2: 130,026,757 T205A probably benign Het
Tll2 G A 19: 41,113,073 T374I probably damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Trim10 G A 17: 36,872,391 S193N probably benign Het
Ttf1 A T 2: 29,073,950 K613* probably null Het
Tube1 T A 10: 39,134,172 probably null Het
Uimc1 T A 13: 55,076,409 probably null Het
Wwp2 G T 8: 107,556,796 probably benign Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp292 T C 4: 34,809,114 D1310G probably benign Het
Zfp575 A T 7: 24,585,820 L132H probably damaging Het
Zmym2 T C 14: 56,956,963 F1226S probably damaging Het
Zswim6 A C 13: 107,726,454 noncoding transcript Het
Other mutations in Strn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Strn3 APN 12 51661196 missense possibly damaging 0.63
IGL00690:Strn3 APN 12 51610438 missense possibly damaging 0.96
IGL00886:Strn3 APN 12 51610150 missense probably damaging 1.00
IGL01967:Strn3 APN 12 51652813 missense probably damaging 1.00
IGL02507:Strn3 APN 12 51661627 nonsense probably null
IGL03139:Strn3 APN 12 51652850 splice site probably benign
IGL03282:Strn3 APN 12 51627209 missense probably benign 0.00
PIT4519001:Strn3 UTSW 12 51633708 missense probably benign 0.00
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0336:Strn3 UTSW 12 51661608 critical splice donor site probably null
R0492:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R0512:Strn3 UTSW 12 51627183 missense possibly damaging 0.94
R0610:Strn3 UTSW 12 51610448 critical splice acceptor site probably null
R0707:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R1562:Strn3 UTSW 12 51633618 missense probably benign
R1599:Strn3 UTSW 12 51652766 missense possibly damaging 0.78
R1663:Strn3 UTSW 12 51652826 missense probably damaging 1.00
R1807:Strn3 UTSW 12 51627203 missense probably benign 0.10
R2263:Strn3 UTSW 12 51643223 splice site probably null
R2443:Strn3 UTSW 12 51627835 missense probably damaging 1.00
R3623:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R3624:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R4154:Strn3 UTSW 12 51627131 missense probably damaging 1.00
R4223:Strn3 UTSW 12 51627855 missense probably damaging 1.00
R4400:Strn3 UTSW 12 51648100 missense possibly damaging 0.85
R4564:Strn3 UTSW 12 51633621 missense probably benign 0.00
R4585:Strn3 UTSW 12 51650170 missense probably benign 0.02
R4755:Strn3 UTSW 12 51610216 missense possibly damaging 0.70
R4794:Strn3 UTSW 12 51650171 missense probably benign 0.38
R5288:Strn3 UTSW 12 51648020 missense probably damaging 1.00
R5308:Strn3 UTSW 12 51629385 missense probably damaging 0.99
R5765:Strn3 UTSW 12 51633627 missense probably benign
R5893:Strn3 UTSW 12 51643223 splice site probably null
R5945:Strn3 UTSW 12 51629496 missense probably benign 0.00
R6244:Strn3 UTSW 12 51610107 missense probably damaging 0.98
R6523:Strn3 UTSW 12 51643098 unclassified probably null
X0024:Strn3 UTSW 12 51652709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACTAAAATACTCCTGGCATGACATT -3'
(R):5'- CCTGCAAAAGACAGTTCCTGCCAAAA -3'

Sequencing Primer
(F):5'- GAAACTTTCTAGCAAGTAG -3'
(R):5'- GAGTGCCTCTTTAGATGTAGAACC -3'
Posted On2013-10-16