Incidental Mutation 'R0834:Parg'
ID77761
Institutional Source Beutler Lab
Gene Symbol Parg
Ensembl Gene ENSMUSG00000021911
Gene Namepoly (ADP-ribose) glycohydrolase
Synonyms
MMRRC Submission 039013-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R0834 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32201949-32297550 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 32214554 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022470] [ENSMUST00000163350] [ENSMUST00000164137] [ENSMUST00000167699] [ENSMUST00000170129] [ENSMUST00000170840]
Predicted Effect probably benign
Transcript: ENSMUST00000022470
SMART Domains Protein: ENSMUSP00000022470
Gene: ENSMUSG00000021911

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 574 902 2.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163350
SMART Domains Protein: ENSMUSP00000131566
Gene: ENSMUSG00000021911

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 570 905 5.1e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164137
Predicted Effect probably benign
Transcript: ENSMUST00000167699
Predicted Effect probably benign
Transcript: ENSMUST00000170129
Predicted Effect probably benign
Transcript: ENSMUST00000170840
SMART Domains Protein: ENSMUSP00000132454
Gene: ENSMUSG00000021911

DomainStartEndE-ValueType
Pfam:PARG_cat 117 452 9.7e-135 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) glycohydrolase (PARG) is the major enzyme responsible for the catabolism of poly(ADP-ribose), a reversible covalent-modifier of chromosomal proteins. The protein is found in many tissues and may be subject to proteolysis generating smaller, active products. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for one allele of this gene are hypersensitive to alkylating agents and ionizing radiation and susceptible to streptozotocin induced diabetes and endotoxic shock. Mice homozygous for a second allele display embryonic lethality and fail tohatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T C 16: 14,093,931 L47P probably damaging Het
Add2 A T 6: 86,086,917 E66V probably damaging Het
Aldh1a3 T C 7: 66,412,910 I156V probably benign Het
Ang4 T A 14: 51,764,268 K74N probably benign Het
Arcn1 A T 9: 44,758,875 probably benign Het
Arhgef33 T A 17: 80,347,597 probably benign Het
Arntl2 A G 6: 146,822,687 H359R probably damaging Het
Atn1 A G 6: 124,743,225 probably benign Het
Brip1 T C 11: 86,192,827 T123A probably benign Het
Camkv A G 9: 107,945,846 Y95C probably damaging Het
Cdk12 T A 11: 98,204,385 S340T probably benign Het
Ckap2l G A 2: 129,296,304 probably benign Het
Clmn A T 12: 104,771,826 L1042Q probably damaging Het
Clmn G T 12: 104,771,827 L1042M probably damaging Het
Cluh T C 11: 74,663,805 V737A probably benign Het
Cpne8 A G 15: 90,540,259 V309A probably benign Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Csmd3 A T 15: 47,883,677 probably benign Het
Ctr9 T A 7: 111,050,952 S818T probably benign Het
Cyp26a1 C T 19: 37,699,957 A309V probably damaging Het
D10Jhu81e T C 10: 78,162,705 D229G probably damaging Het
Dbndd2 C T 2: 164,490,202 T115I possibly damaging Het
Ddx58 T A 4: 40,239,596 E34V possibly damaging Het
Dhcr7 A G 7: 143,841,227 N157S probably benign Het
Dlx2 C A 2: 71,545,515 V155F probably damaging Het
Duox1 A T 2: 122,346,501 I1470F probably damaging Het
Esrrb A T 12: 86,470,297 I68F probably benign Het
Fhod3 T A 18: 25,115,805 L1347* probably null Het
Fip1l1 T C 5: 74,595,060 probably benign Het
Frem3 A G 8: 80,687,008 Y1966C probably damaging Het
Ggt5 C T 10: 75,604,770 R242C possibly damaging Het
Gm14496 G A 2: 181,995,687 V185I probably benign Het
Gnptab T C 10: 88,429,952 V409A probably damaging Het
Gramd1a A G 7: 31,138,164 F390S possibly damaging Het
Helz2 A G 2: 181,230,777 S2477P probably damaging Het
Hsd17b3 T C 13: 64,089,122 K3E probably benign Het
Ift172 T C 5: 31,257,371 H1395R probably benign Het
Jam2 T A 16: 84,812,967 C180S probably damaging Het
Kalrn A C 16: 34,049,919 S160A possibly damaging Het
Kcnk3 T C 5: 30,622,635 I343T probably damaging Het
Kif13a T C 13: 46,814,236 E334G probably damaging Het
Klhl41 A G 2: 69,678,147 K482E possibly damaging Het
Lig3 A G 11: 82,798,287 E794G probably damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Ndst2 A G 14: 20,729,693 Y160H probably damaging Het
Ndufb10 T C 17: 24,722,674 M90V probably damaging Het
Obscn T C 11: 59,133,278 K522R probably benign Het
Olfml2b T C 1: 170,647,844 S113P probably benign Het
Olfr1251 A G 2: 89,667,079 I269T probably benign Het
Olfr1424 T A 19: 12,059,615 M46L probably benign Het
Olfr298 T A 7: 86,489,490 E20D probably benign Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr620 T C 7: 103,612,237 T39A probably benign Het
Pde7a C T 3: 19,230,318 C367Y probably damaging Het
Pigr T A 1: 130,844,544 C166* probably null Het
Pip4k2c A T 10: 127,200,835 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkd2 A T 7: 16,865,677 probably benign Het
Ptprt G T 2: 161,812,139 probably null Het
Rapgef5 C T 12: 117,647,121 probably benign Het
Retreg1 T C 15: 25,971,670 L356P probably benign Het
Rnf43 A G 11: 87,731,251 T393A probably benign Het
Samd3 T C 10: 26,271,827 S467P probably benign Het
Scarf1 C A 11: 75,514,403 C89* probably null Het
Sdk1 T C 5: 141,242,024 L59S probably benign Het
Sgca C T 11: 94,970,686 W244* probably null Het
Sh3d21 T C 4: 126,151,272 K538R probably benign Het
Smyd4 T A 11: 75,391,132 L477Q possibly damaging Het
Sra1 A G 18: 36,668,776 M87T probably benign Het
Ssh2 T C 11: 77,437,633 Y336H possibly damaging Het
Steap1 T C 5: 5,740,357 Y197C probably damaging Het
Strn3 A G 12: 51,627,096 probably benign Het
Tgm3 A G 2: 130,026,757 T205A probably benign Het
Tll2 G A 19: 41,113,073 T374I probably damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Trim10 G A 17: 36,872,391 S193N probably benign Het
Ttf1 A T 2: 29,073,950 K613* probably null Het
Tube1 T A 10: 39,134,172 probably null Het
Uimc1 T A 13: 55,076,409 probably null Het
Wwp2 G T 8: 107,556,796 probably benign Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp292 T C 4: 34,809,114 D1310G probably benign Het
Zfp575 A T 7: 24,585,820 L132H probably damaging Het
Zmym2 T C 14: 56,956,963 F1226S probably damaging Het
Zswim6 A C 13: 107,726,454 noncoding transcript Het
Other mutations in Parg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Parg APN 14 32296185 splice site probably benign
IGL01879:Parg APN 14 32271622 splice site probably benign
IGL02391:Parg APN 14 32262681 splice site probably null
IGL02451:Parg APN 14 32242229 missense probably damaging 1.00
IGL02598:Parg APN 14 32214324 missense probably damaging 1.00
IGL02899:Parg APN 14 32238574 missense probably damaging 1.00
R0112:Parg UTSW 14 32202433 missense probably damaging 1.00
R0167:Parg UTSW 14 32217736 critical splice donor site probably null
R0514:Parg UTSW 14 32254560 missense possibly damaging 0.69
R1140:Parg UTSW 14 32296243 missense probably benign 0.01
R1480:Parg UTSW 14 32209628 nonsense probably null
R1611:Parg UTSW 14 32238570 missense probably damaging 1.00
R1912:Parg UTSW 14 32210540 missense probably damaging 0.99
R1916:Parg UTSW 14 32208227 splice site probably benign
R1983:Parg UTSW 14 32217696 missense probably damaging 1.00
R2007:Parg UTSW 14 32210574 missense possibly damaging 0.87
R2275:Parg UTSW 14 32295238 missense probably damaging 0.98
R2942:Parg UTSW 14 32209337 missense probably damaging 1.00
R4206:Parg UTSW 14 32254536 missense probably benign 0.07
R4482:Parg UTSW 14 32262774 missense probably damaging 1.00
R4512:Parg UTSW 14 32262736 missense probably damaging 1.00
R4519:Parg UTSW 14 32209635 missense probably damaging 1.00
R4611:Parg UTSW 14 32274864 missense probably damaging 1.00
R4831:Parg UTSW 14 32202451 missense probably benign 0.00
R4876:Parg UTSW 14 32271668 missense probably damaging 0.98
R5298:Parg UTSW 14 32202253 missense probably damaging 1.00
R5606:Parg UTSW 14 32262736 missense probably damaging 1.00
R5782:Parg UTSW 14 32274905 nonsense probably null
R5878:Parg UTSW 14 32217662 missense possibly damaging 0.85
R6373:Parg UTSW 14 32209497 unclassified probably null
R6436:Parg UTSW 14 32271677 missense probably damaging 1.00
R6530:Parg UTSW 14 32209199 missense probably damaging 1.00
R7285:Parg UTSW 14 32210508 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCATTTGCCTGAGCTGCTTCC -3'
(R):5'- ACATTGCACATGAAGATTGCTGCC -3'

Sequencing Primer
(F):5'- TCAGGTAGACCTTCTGAGAGC -3'
(R):5'- ACCTCTCAGCTGGCTCTATA -3'
Posted On2013-10-16