Incidental Mutation 'R0834:Ppp1r16a'
ID77765
Institutional Source Beutler Lab
Gene Symbol Ppp1r16a
Ensembl Gene ENSMUSG00000033819
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 16A
SynonymsR75527, Mypt3, 2900084E10Rik
MMRRC Submission 039013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R0834 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76671615-76694919 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 76693669 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 328 (Q328*)
Ref Sequence ENSEMBL: ENSMUSP00000155515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023203] [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000231028]
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000037551
AA Change: Q328*
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819
AA Change: Q328*

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134449
Predicted Effect probably null
Transcript: ENSMUST00000135388
AA Change: Q328*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143274
Predicted Effect probably benign
Transcript: ENSMUST00000150399
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Meta Mutation Damage Score 0.66 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while other MYPTs result in PP1c activation after becoming phosphorylated, the encoded protein is phosphorylated by protein kinase A and then inhibits the catalytic activity of PP1c. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T C 16: 14,093,931 L47P probably damaging Het
Add2 A T 6: 86,086,917 E66V probably damaging Het
Aldh1a3 T C 7: 66,412,910 I156V probably benign Het
Ang4 T A 14: 51,764,268 K74N probably benign Het
Arcn1 A T 9: 44,758,875 probably benign Het
Arhgef33 T A 17: 80,347,597 probably benign Het
Arntl2 A G 6: 146,822,687 H359R probably damaging Het
Atn1 A G 6: 124,743,225 probably benign Het
Brip1 T C 11: 86,192,827 T123A probably benign Het
Camkv A G 9: 107,945,846 Y95C probably damaging Het
Cdk12 T A 11: 98,204,385 S340T probably benign Het
Ckap2l G A 2: 129,296,304 probably benign Het
Clmn A T 12: 104,771,826 L1042Q probably damaging Het
Clmn G T 12: 104,771,827 L1042M probably damaging Het
Cluh T C 11: 74,663,805 V737A probably benign Het
Cpne8 A G 15: 90,540,259 V309A probably benign Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Csmd3 A T 15: 47,883,677 probably benign Het
Ctr9 T A 7: 111,050,952 S818T probably benign Het
Cyp26a1 C T 19: 37,699,957 A309V probably damaging Het
D10Jhu81e T C 10: 78,162,705 D229G probably damaging Het
Dbndd2 C T 2: 164,490,202 T115I possibly damaging Het
Ddx58 T A 4: 40,239,596 E34V possibly damaging Het
Dhcr7 A G 7: 143,841,227 N157S probably benign Het
Dlx2 C A 2: 71,545,515 V155F probably damaging Het
Duox1 A T 2: 122,346,501 I1470F probably damaging Het
Esrrb A T 12: 86,470,297 I68F probably benign Het
Fhod3 T A 18: 25,115,805 L1347* probably null Het
Fip1l1 T C 5: 74,595,060 probably benign Het
Frem3 A G 8: 80,687,008 Y1966C probably damaging Het
Ggt5 C T 10: 75,604,770 R242C possibly damaging Het
Gm14496 G A 2: 181,995,687 V185I probably benign Het
Gnptab T C 10: 88,429,952 V409A probably damaging Het
Gramd1a A G 7: 31,138,164 F390S possibly damaging Het
Helz2 A G 2: 181,230,777 S2477P probably damaging Het
Hsd17b3 T C 13: 64,089,122 K3E probably benign Het
Ift172 T C 5: 31,257,371 H1395R probably benign Het
Jam2 T A 16: 84,812,967 C180S probably damaging Het
Kalrn A C 16: 34,049,919 S160A possibly damaging Het
Kcnk3 T C 5: 30,622,635 I343T probably damaging Het
Kif13a T C 13: 46,814,236 E334G probably damaging Het
Klhl41 A G 2: 69,678,147 K482E possibly damaging Het
Lig3 A G 11: 82,798,287 E794G probably damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Ndst2 A G 14: 20,729,693 Y160H probably damaging Het
Ndufb10 T C 17: 24,722,674 M90V probably damaging Het
Obscn T C 11: 59,133,278 K522R probably benign Het
Olfml2b T C 1: 170,647,844 S113P probably benign Het
Olfr1251 A G 2: 89,667,079 I269T probably benign Het
Olfr1424 T A 19: 12,059,615 M46L probably benign Het
Olfr298 T A 7: 86,489,490 E20D probably benign Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr620 T C 7: 103,612,237 T39A probably benign Het
Parg T C 14: 32,214,554 probably benign Het
Pde7a C T 3: 19,230,318 C367Y probably damaging Het
Pigr T A 1: 130,844,544 C166* probably null Het
Pip4k2c A T 10: 127,200,835 probably benign Het
Prkd2 A T 7: 16,865,677 probably benign Het
Ptprt G T 2: 161,812,139 probably null Het
Rapgef5 C T 12: 117,647,121 probably benign Het
Retreg1 T C 15: 25,971,670 L356P probably benign Het
Rnf43 A G 11: 87,731,251 T393A probably benign Het
Samd3 T C 10: 26,271,827 S467P probably benign Het
Scarf1 C A 11: 75,514,403 C89* probably null Het
Sdk1 T C 5: 141,242,024 L59S probably benign Het
Sgca C T 11: 94,970,686 W244* probably null Het
Sh3d21 T C 4: 126,151,272 K538R probably benign Het
Smyd4 T A 11: 75,391,132 L477Q possibly damaging Het
Sra1 A G 18: 36,668,776 M87T probably benign Het
Ssh2 T C 11: 77,437,633 Y336H possibly damaging Het
Steap1 T C 5: 5,740,357 Y197C probably damaging Het
Strn3 A G 12: 51,627,096 probably benign Het
Tgm3 A G 2: 130,026,757 T205A probably benign Het
Tll2 G A 19: 41,113,073 T374I probably damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Trim10 G A 17: 36,872,391 S193N probably benign Het
Ttf1 A T 2: 29,073,950 K613* probably null Het
Tube1 T A 10: 39,134,172 probably null Het
Uimc1 T A 13: 55,076,409 probably null Het
Wwp2 G T 8: 107,556,796 probably benign Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp292 T C 4: 34,809,114 D1310G probably benign Het
Zfp575 A T 7: 24,585,820 L132H probably damaging Het
Zmym2 T C 14: 56,956,963 F1226S probably damaging Het
Zswim6 A C 13: 107,726,454 noncoding transcript Het
Other mutations in Ppp1r16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Ppp1r16a APN 15 76694544 missense probably benign
IGL01449:Ppp1r16a APN 15 76694294 unclassified probably benign
IGL02128:Ppp1r16a APN 15 76693978 missense probably benign
IGL02331:Ppp1r16a APN 15 76691000 missense probably benign
R0057:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0060:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0113:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0114:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0244:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0352:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0646:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0652:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0722:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0744:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0833:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0835:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0836:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0885:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0942:Ppp1r16a UTSW 15 76694011 missense probably damaging 0.98
R1061:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1168:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1170:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1171:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1503:Ppp1r16a UTSW 15 76694399 missense probably benign
R1572:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1914:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R1915:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R2085:Ppp1r16a UTSW 15 76693596 missense probably damaging 0.99
R4823:Ppp1r16a UTSW 15 76693193 unclassified probably benign
R5153:Ppp1r16a UTSW 15 76694396 nonsense probably null
R5443:Ppp1r16a UTSW 15 76694646 missense possibly damaging 0.95
R5481:Ppp1r16a UTSW 15 76691021 missense probably damaging 1.00
R6900:Ppp1r16a UTSW 15 76691723 missense probably damaging 1.00
R7165:Ppp1r16a UTSW 15 76690904 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCTCTGGTGGACGAGACACCC -3'
(R):5'- ATGCTCCTTGCGGTACAGGTTG -3'

Sequencing Primer
(F):5'- ACCCCTCGGTGAGTGTG -3'
(R):5'- ATGTGTCAGGCTCACTCG -3'
Posted On2013-10-16