Incidental Mutation 'R0834:Ndufb10'
ID77770
Institutional Source Beutler Lab
Gene Symbol Ndufb10
Ensembl Gene ENSMUSG00000040048
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10
Synonyms22kDa, 0610011B04Rik
MMRRC Submission 039013-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R0834 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24722060-24724478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24722674 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 90 (M90V)
Ref Sequence ENSEMBL: ENSMUSP00000043543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008626] [ENSMUST00000045602] [ENSMUST00000054289] [ENSMUST00000135708] [ENSMUST00000146867] [ENSMUST00000152407] [ENSMUST00000170715]
Predicted Effect probably benign
Transcript: ENSMUST00000008626
SMART Domains Protein: ENSMUSP00000008626
Gene: ENSMUSG00000008482

DomainStartEndE-ValueType
RING 20 57 1.76e-5 SMART
Pfam:zf-TRAF 102 158 7.5e-9 PFAM
low complexity region 176 193 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045602
AA Change: M90V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043543
Gene: ENSMUSG00000040048
AA Change: M90V

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 42 168 2.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054289
SMART Domains Protein: ENSMUSP00000092502
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 5.7e-34 PFAM
Pfam:Ribosomal_S5_C 185 256 2.4e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132803
Predicted Effect possibly damaging
Transcript: ENSMUST00000135708
AA Change: M105V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120091
Gene: ENSMUSG00000040048
AA Change: M105V

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 54 149 7.1e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144285
Predicted Effect probably benign
Transcript: ENSMUST00000146867
SMART Domains Protein: ENSMUSP00000120715
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 1.7e-35 PFAM
Pfam:Ribosomal_S5_C 185 256 8.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147648
Predicted Effect probably benign
Transcript: ENSMUST00000152407
SMART Domains Protein: ENSMUSP00000114529
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 9.2e-32 PFAM
Pfam:Ribosomal_S5_C 184 257 1.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161706
Predicted Effect probably benign
Transcript: ENSMUST00000170715
SMART Domains Protein: ENSMUSP00000131474
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 1.1e-31 PFAM
Pfam:Ribosomal_S5_C 184 257 1.3e-24 PFAM
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (86/86)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T C 16: 14,093,931 L47P probably damaging Het
Add2 A T 6: 86,086,917 E66V probably damaging Het
Aldh1a3 T C 7: 66,412,910 I156V probably benign Het
Ang4 T A 14: 51,764,268 K74N probably benign Het
Arcn1 A T 9: 44,758,875 probably benign Het
Arhgef33 T A 17: 80,347,597 probably benign Het
Arntl2 A G 6: 146,822,687 H359R probably damaging Het
Atn1 A G 6: 124,743,225 probably benign Het
Brip1 T C 11: 86,192,827 T123A probably benign Het
Camkv A G 9: 107,945,846 Y95C probably damaging Het
Cdk12 T A 11: 98,204,385 S340T probably benign Het
Ckap2l G A 2: 129,296,304 probably benign Het
Clmn A T 12: 104,771,826 L1042Q probably damaging Het
Clmn G T 12: 104,771,827 L1042M probably damaging Het
Cluh T C 11: 74,663,805 V737A probably benign Het
Cpne8 A G 15: 90,540,259 V309A probably benign Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Csmd3 A T 15: 47,883,677 probably benign Het
Ctr9 T A 7: 111,050,952 S818T probably benign Het
Cyp26a1 C T 19: 37,699,957 A309V probably damaging Het
D10Jhu81e T C 10: 78,162,705 D229G probably damaging Het
Dbndd2 C T 2: 164,490,202 T115I possibly damaging Het
Ddx58 T A 4: 40,239,596 E34V possibly damaging Het
Dhcr7 A G 7: 143,841,227 N157S probably benign Het
Dlx2 C A 2: 71,545,515 V155F probably damaging Het
Duox1 A T 2: 122,346,501 I1470F probably damaging Het
Esrrb A T 12: 86,470,297 I68F probably benign Het
Fhod3 T A 18: 25,115,805 L1347* probably null Het
Fip1l1 T C 5: 74,595,060 probably benign Het
Frem3 A G 8: 80,687,008 Y1966C probably damaging Het
Ggt5 C T 10: 75,604,770 R242C possibly damaging Het
Gm14496 G A 2: 181,995,687 V185I probably benign Het
Gnptab T C 10: 88,429,952 V409A probably damaging Het
Gramd1a A G 7: 31,138,164 F390S possibly damaging Het
Helz2 A G 2: 181,230,777 S2477P probably damaging Het
Hsd17b3 T C 13: 64,089,122 K3E probably benign Het
Ift172 T C 5: 31,257,371 H1395R probably benign Het
Jam2 T A 16: 84,812,967 C180S probably damaging Het
Kalrn A C 16: 34,049,919 S160A possibly damaging Het
Kcnk3 T C 5: 30,622,635 I343T probably damaging Het
Kif13a T C 13: 46,814,236 E334G probably damaging Het
Klhl41 A G 2: 69,678,147 K482E possibly damaging Het
Lig3 A G 11: 82,798,287 E794G probably damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Ndst2 A G 14: 20,729,693 Y160H probably damaging Het
Obscn T C 11: 59,133,278 K522R probably benign Het
Olfml2b T C 1: 170,647,844 S113P probably benign Het
Olfr1251 A G 2: 89,667,079 I269T probably benign Het
Olfr1424 T A 19: 12,059,615 M46L probably benign Het
Olfr298 T A 7: 86,489,490 E20D probably benign Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr620 T C 7: 103,612,237 T39A probably benign Het
Parg T C 14: 32,214,554 probably benign Het
Pde7a C T 3: 19,230,318 C367Y probably damaging Het
Pigr T A 1: 130,844,544 C166* probably null Het
Pip4k2c A T 10: 127,200,835 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkd2 A T 7: 16,865,677 probably benign Het
Ptprt G T 2: 161,812,139 probably null Het
Rapgef5 C T 12: 117,647,121 probably benign Het
Retreg1 T C 15: 25,971,670 L356P probably benign Het
Rnf43 A G 11: 87,731,251 T393A probably benign Het
Samd3 T C 10: 26,271,827 S467P probably benign Het
Scarf1 C A 11: 75,514,403 C89* probably null Het
Sdk1 T C 5: 141,242,024 L59S probably benign Het
Sgca C T 11: 94,970,686 W244* probably null Het
Sh3d21 T C 4: 126,151,272 K538R probably benign Het
Smyd4 T A 11: 75,391,132 L477Q possibly damaging Het
Sra1 A G 18: 36,668,776 M87T probably benign Het
Ssh2 T C 11: 77,437,633 Y336H possibly damaging Het
Steap1 T C 5: 5,740,357 Y197C probably damaging Het
Strn3 A G 12: 51,627,096 probably benign Het
Tgm3 A G 2: 130,026,757 T205A probably benign Het
Tll2 G A 19: 41,113,073 T374I probably damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Trim10 G A 17: 36,872,391 S193N probably benign Het
Ttf1 A T 2: 29,073,950 K613* probably null Het
Tube1 T A 10: 39,134,172 probably null Het
Uimc1 T A 13: 55,076,409 probably null Het
Wwp2 G T 8: 107,556,796 probably benign Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp292 T C 4: 34,809,114 D1310G probably benign Het
Zfp575 A T 7: 24,585,820 L132H probably damaging Het
Zmym2 T C 14: 56,956,963 F1226S probably damaging Het
Zswim6 A C 13: 107,726,454 noncoding transcript Het
Other mutations in Ndufb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Ndufb10 APN 17 24724184 splice site probably null
R0157:Ndufb10 UTSW 17 24724244 missense probably benign 0.39
R0189:Ndufb10 UTSW 17 24724235 missense probably benign 0.16
R1164:Ndufb10 UTSW 17 24722783 missense probably benign 0.22
R2015:Ndufb10 UTSW 17 24722529 splice site probably null
R4687:Ndufb10 UTSW 17 24722419 missense possibly damaging 0.89
R4995:Ndufb10 UTSW 17 24722757 unclassified probably null
R5629:Ndufb10 UTSW 17 24722682 missense probably damaging 1.00
R7310:Ndufb10 UTSW 17 24722214 missense probably damaging 0.99
X0024:Ndufb10 UTSW 17 24722178 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAAGCCTTCAGTCTCTCCTGGATG -3'
(R):5'- AGTTTGGGACTACAGACCCTTCGC -3'

Sequencing Primer
(F):5'- GATGTTCATGATCTCCTGGTCAAC -3'
(R):5'- CGCCTCAAGCTGCTTCAG -3'
Posted On2013-10-16