Incidental Mutation 'R0835:Nek6'
ID77783
Institutional Source Beutler Lab
Gene Symbol Nek6
Ensembl Gene ENSMUSG00000026749
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms1300007C09Rik
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R0835 (G1)
Quality Score216
Status Not validated
Chromosome2
Chromosomal Location38511643-38594606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38569631 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 162 (I162N)
Ref Sequence ENSEMBL: ENSMUSP00000108523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054234] [ENSMUST00000112895] [ENSMUST00000112902]
Predicted Effect probably benign
Transcript: ENSMUST00000054234
AA Change: I173N

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049723
Gene: ENSMUSG00000026749
AA Change: I173N

DomainStartEndE-ValueType
S_TKc 45 310 3.01e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112895
AA Change: I173N

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108516
Gene: ENSMUSG00000026749
AA Change: I173N

DomainStartEndE-ValueType
S_TKc 45 310 3.01e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112902
AA Change: I162N

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108523
Gene: ENSMUSG00000026749
AA Change: I162N

DomainStartEndE-ValueType
S_TKc 34 299 3.01e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203964
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype Strain: 5427679
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: No significant homozygous or heterozygous mutant phenotype was detected in a high throughput screen of a targeted mutation, however these homozygotes exhibit an increased response of the heart to induced stress, with aggravated cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(128) : Targeted(3) Gene trapped(125)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Nek6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03112:Nek6 APN 2 38560902 missense probably damaging 1.00
P0005:Nek6 UTSW 2 38569737 critical splice donor site probably null
R0014:Nek6 UTSW 2 38558844 splice site probably benign
R0674:Nek6 UTSW 2 38558904 missense possibly damaging 0.79
R0709:Nek6 UTSW 2 38557846 missense probably damaging 0.99
R1548:Nek6 UTSW 2 38568895 missense probably damaging 0.99
R1773:Nek6 UTSW 2 38582419 missense probably benign 0.25
R1901:Nek6 UTSW 2 38582446 missense probably damaging 1.00
R4080:Nek6 UTSW 2 38550637 missense probably damaging 0.99
R4563:Nek6 UTSW 2 38585293 missense probably damaging 1.00
R6207:Nek6 UTSW 2 38557834 missense possibly damaging 0.82
R6865:Nek6 UTSW 2 38569666 missense probably benign
R7339:Nek6 UTSW 2 38560965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGCTTTCACCTGTGTGAGACCC -3'
(R):5'- AAGCCAGGCAGATGCAGTCCATTC -3'

Sequencing Primer
(F):5'- CAGTGCAAAGCTTACTGACTGTC -3'
(R):5'- GCAGTCCATTCTATATGACAGGGTC -3'
Posted On2013-10-16