Incidental Mutation 'R0835:Dync1i2'
ID77785
Institutional Source Beutler Lab
Gene Symbol Dync1i2
Ensembl Gene ENSMUSG00000027012
Gene Namedynein cytoplasmic 1 intermediate chain 2
Synonyms3110079H08Rik, Dncic2
MMRRC Submission 039014-MU
Accession Numbers

Genbank: NM_010064; MGI: 107750

Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71211706-71263303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71250972 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 508 (L508F)
Ref Sequence ENSEMBL: ENSMUSP00000107772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081710] [ENSMUST00000100028] [ENSMUST00000112136] [ENSMUST00000112138] [ENSMUST00000112139] [ENSMUST00000112140] [ENSMUST00000112142] [ENSMUST00000112144]
Predicted Effect probably damaging
Transcript: ENSMUST00000081710
AA Change: L482F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080410
Gene: ENSMUSG00000027012
AA Change: L482F

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100028
AA Change: L502F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097605
Gene: ENSMUSG00000027012
AA Change: L502F

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112136
AA Change: L508F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107764
Gene: ENSMUSG00000027012
AA Change: L508F

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 5e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 618 632 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112138
AA Change: L482F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107766
Gene: ENSMUSG00000027012
AA Change: L482F

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112139
AA Change: L482F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107767
Gene: ENSMUSG00000027012
AA Change: L482F

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 4.5e-21 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 592 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112140
AA Change: L508F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107768
Gene: ENSMUSG00000027012
AA Change: L508F

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112142
AA Change: L502F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107770
Gene: ENSMUSG00000027012
AA Change: L502F

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112144
AA Change: L508F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107772
Gene: ENSMUSG00000027012
AA Change: L508F

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 133 163 6.5e-19 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141619
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit a trend towards slight locomotor deficit. [provided by MGI curators]
Allele List at MGI

All alleles(50) : Targeted, other(2) Gene trapped(48)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Dync1i2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Dync1i2 APN 2 71247955 splice site probably benign
IGL01609:Dync1i2 APN 2 71247008 splice site probably benign
IGL02479:Dync1i2 APN 2 71235979 missense probably damaging 1.00
IGL02545:Dync1i2 APN 2 71262751 missense possibly damaging 0.95
3-1:Dync1i2 UTSW 2 71247828 missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71214484 missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71214484 missense probably damaging 1.00
R0437:Dync1i2 UTSW 2 71227825 critical splice acceptor site probably null
R0555:Dync1i2 UTSW 2 71214518 frame shift probably null
R1146:Dync1i2 UTSW 2 71227820 splice site probably benign
R1452:Dync1i2 UTSW 2 71249863 splice site probably benign
R1662:Dync1i2 UTSW 2 71250979 missense possibly damaging 0.87
R1765:Dync1i2 UTSW 2 71249415 missense probably benign
R2059:Dync1i2 UTSW 2 71249853 critical splice donor site probably null
R2145:Dync1i2 UTSW 2 71214563 splice site probably benign
R2233:Dync1i2 UTSW 2 71249420 nonsense probably null
R2234:Dync1i2 UTSW 2 71249420 nonsense probably null
R2235:Dync1i2 UTSW 2 71249420 nonsense probably null
R3151:Dync1i2 UTSW 2 71233716 splice site probably benign
R3916:Dync1i2 UTSW 2 71249372 missense probably damaging 1.00
R4653:Dync1i2 UTSW 2 71247855 missense probably damaging 1.00
R4720:Dync1i2 UTSW 2 71233674 missense probably damaging 1.00
R4920:Dync1i2 UTSW 2 71247324 missense probably damaging 1.00
R5574:Dync1i2 UTSW 2 71233650 missense probably benign 0.15
R5620:Dync1i2 UTSW 2 71258139 missense probably benign 0.00
R5677:Dync1i2 UTSW 2 71228623 missense probably benign 0.00
R5711:Dync1i2 UTSW 2 71250982 missense probably benign 0.31
R6730:Dync1i2 UTSW 2 71247140 missense probably benign 0.18
R6911:Dync1i2 UTSW 2 71247102 missense probably benign
R7140:Dync1i2 UTSW 2 71247939 missense probably benign 0.03
R7257:Dync1i2 UTSW 2 71249356 missense possibly damaging 0.92
R7460:Dync1i2 UTSW 2 71250886 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGTGTACTTCCAAGAGAGGTCCC -3'
(R):5'- GCTCTCCACAGAGCAAATGAATGGC -3'

Sequencing Primer
(F):5'- TCACTGGAATCCACTGTCAC -3'
(R):5'- GGAGGAAGCCTACTCTTCAACTG -3'
Posted On2013-10-16