Incidental Mutation 'R0835:Slc12a5'
ID77791
Institutional Source Beutler Lab
Gene Symbol Slc12a5
Ensembl Gene ENSMUSG00000017740
Gene Namesolute carrier family 12, member 5
SynonymsKCC2
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164960802-164999731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164994038 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 892 (I892N)
Ref Sequence ENSEMBL: ENSMUSP00000144623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099092
AA Change: I869N

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: I869N

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 304 5.2e-22 PFAM
Pfam:AA_permease_2 364 632 1e-17 PFAM
Pfam:AA_permease 389 676 1.9e-42 PFAM
Pfam:SLC12 688 814 2.1e-19 PFAM
Pfam:SLC12 807 959 1.8e-20 PFAM
low complexity region 978 1002 N/A INTRINSIC
Pfam:SLC12 1009 1115 2.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137302
Predicted Effect probably benign
Transcript: ENSMUST00000202136
SMART Domains Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 175 2.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202223
AA Change: I892N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: I892N

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 1e-19 PFAM
Pfam:AA_permease_2 386 655 4.5e-15 PFAM
Pfam:AA_permease 412 699 3.7e-40 PFAM
Pfam:SLC12 711 837 7.2e-17 PFAM
Pfam:SLC12 830 982 6.2e-18 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1030 1133 8.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202479
SMART Domains Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 176 5.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202623
AA Change: I892N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: I892N

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 5.3e-22 PFAM
Pfam:AA_permease_2 386 655 1.2e-17 PFAM
Pfam:AA_permease 412 699 2e-42 PFAM
Pfam:SLC12 711 837 2.1e-19 PFAM
Pfam:SLC12 830 982 1.8e-20 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1032 1138 2.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Slc12a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Slc12a5 APN 2 164997121 missense probably damaging 1.00
IGL00425:Slc12a5 APN 2 164983281 missense probably damaging 1.00
IGL00976:Slc12a5 APN 2 164979304 missense probably damaging 1.00
IGL01654:Slc12a5 APN 2 164973755 missense possibly damaging 0.91
IGL01905:Slc12a5 APN 2 164990381 missense probably benign 0.02
IGL02205:Slc12a5 APN 2 164996479 missense probably benign 0.03
IGL02510:Slc12a5 APN 2 164982808 splice site probably benign
IGL02746:Slc12a5 APN 2 164974916 missense probably benign 0.01
R0051:Slc12a5 UTSW 2 164986663 missense probably damaging 1.00
R0254:Slc12a5 UTSW 2 164997245 critical splice donor site probably null
R0412:Slc12a5 UTSW 2 164994062 missense probably benign 0.05
R0587:Slc12a5 UTSW 2 164976533 missense probably damaging 1.00
R0932:Slc12a5 UTSW 2 164996885 splice site probably benign
R1643:Slc12a5 UTSW 2 164994027 missense probably benign 0.01
R1700:Slc12a5 UTSW 2 164992376 missense possibly damaging 0.94
R1760:Slc12a5 UTSW 2 164996128 missense probably damaging 0.99
R2063:Slc12a5 UTSW 2 164997147 missense probably damaging 1.00
R2293:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R2412:Slc12a5 UTSW 2 164976462 critical splice donor site probably null
R3035:Slc12a5 UTSW 2 164980258 missense probably benign 0.06
R3116:Slc12a5 UTSW 2 164996181 intron probably null
R3412:Slc12a5 UTSW 2 164968431 missense probably benign 0.26
R3788:Slc12a5 UTSW 2 164993775 missense probably damaging 1.00
R4039:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R4174:Slc12a5 UTSW 2 164979490 missense probably damaging 1.00
R4492:Slc12a5 UTSW 2 164979343 missense probably benign 0.08
R4608:Slc12a5 UTSW 2 164973765 missense probably damaging 0.99
R4750:Slc12a5 UTSW 2 164982931 missense probably benign 0.06
R4994:Slc12a5 UTSW 2 164983365 intron probably null
R5103:Slc12a5 UTSW 2 164992433 missense probably damaging 1.00
R5539:Slc12a5 UTSW 2 164987206 missense possibly damaging 0.94
R5632:Slc12a5 UTSW 2 164987221 missense possibly damaging 0.86
R5771:Slc12a5 UTSW 2 164973768 missense possibly damaging 0.88
R6139:Slc12a5 UTSW 2 164992311 missense probably damaging 0.98
R6336:Slc12a5 UTSW 2 164992464 intron probably null
R6581:Slc12a5 UTSW 2 164987115 missense probably damaging 1.00
R6706:Slc12a5 UTSW 2 164988589 missense probably damaging 1.00
R6886:Slc12a5 UTSW 2 164982905 missense probably benign
R7134:Slc12a5 UTSW 2 164974958 missense probably damaging 1.00
R7310:Slc12a5 UTSW 2 164992440 missense probably damaging 1.00
R7402:Slc12a5 UTSW 2 164982932 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGCTGGTCACCAAGAATGTTTCC -3'
(R):5'- GAAGGCGACCTGTATCATCCACTG -3'

Sequencing Primer
(F):5'- CAATGTCCATGTAGGTGTGTCC -3'
(R):5'- GTATCATCCACTGACGGCTATG -3'
Posted On2013-10-16