Incidental Mutation 'R0835:Myo16'
ID77827
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Namemyosin XVI
SynonymsBM140241, C230040D10Rik, Nyap3
MMRRC Submission 039014-MU
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location10153911-10634742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10272766 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 65 (Q65H)
Ref Sequence ENSEMBL: ENSMUSP00000147072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207477] [ENSMUST00000208309] [ENSMUST00000214643]
Predicted Effect probably damaging
Transcript: ENSMUST00000042103
AA Change: Q65H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057
AA Change: Q65H

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207204
AA Change: Q65H
Predicted Effect unknown
Transcript: ENSMUST00000207477
AA Change: Q65H
Predicted Effect probably damaging
Transcript: ENSMUST00000208309
AA Change: Q65H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214643
AA Change: Q87H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0142:Myo16 UTSW 8 10569790 missense probably benign 0.01
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0627:Myo16 UTSW 8 10439689 missense probably benign 0.15
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10396908 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2214:Myo16 UTSW 8 10438803 missense probably damaging 1.00
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5517:Myo16 UTSW 8 10560226 missense probably benign 0.22
R5567:Myo16 UTSW 8 10322676 missense probably damaging 1.00
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6213:Myo16 UTSW 8 10370963 critical splice donor site probably null
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
R7398:Myo16 UTSW 8 10562183 missense unknown
R7442:Myo16 UTSW 8 10272537 missense probably damaging 1.00
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACCAGTGCTTGCTGGAGTC -3'
(R):5'- CCTCGACAAATTCTGAGGCAACTGAC -3'

Sequencing Primer
(F):5'- TGGAGTCCCTCCCCCTG -3'
(R):5'- gcgaccctttaacacagttcc -3'
Posted On2013-10-16