Incidental Mutation 'R0835:Cep126'
ID77833
Institutional Source Beutler Lab
Gene Symbol Cep126
Ensembl Gene ENSMUSG00000040729
Gene Namecentrosomal protein 126
SynonymsAK129341
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location8076461-8134294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8130223 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 69 (Y69C)
Ref Sequence ENSEMBL: ENSMUSP00000042904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037397]
Predicted Effect probably damaging
Transcript: ENSMUST00000037397
AA Change: Y69C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042904
Gene: ENSMUSG00000040729
AA Change: Y69C

DomainStartEndE-ValueType
low complexity region 6 36 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:K1377 100 1061 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Cep126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Cep126 APN 9 8103319 missense possibly damaging 0.57
IGL01967:Cep126 APN 9 8095208 splice site probably null
IGL02065:Cep126 APN 9 8099924 missense probably benign 0.09
IGL03215:Cep126 APN 9 8100530 nonsense probably null
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0064:Cep126 UTSW 9 8130182 splice site probably benign
R0184:Cep126 UTSW 9 8103395 missense probably benign 0.19
R0980:Cep126 UTSW 9 8100719 missense probably damaging 0.99
R1288:Cep126 UTSW 9 8112181 missense probably benign 0.01
R1341:Cep126 UTSW 9 8099776 missense possibly damaging 0.78
R1351:Cep126 UTSW 9 8100086 missense probably damaging 0.99
R1484:Cep126 UTSW 9 8100553 missense possibly damaging 0.81
R1707:Cep126 UTSW 9 8100382 missense probably benign 0.00
R1732:Cep126 UTSW 9 8099761 missense probably benign
R1903:Cep126 UTSW 9 8120747 missense possibly damaging 0.58
R1968:Cep126 UTSW 9 8100908 missense probably damaging 1.00
R2216:Cep126 UTSW 9 8120678 missense probably damaging 1.00
R2260:Cep126 UTSW 9 8101748 missense possibly damaging 0.50
R2444:Cep126 UTSW 9 8101306 missense probably damaging 1.00
R4208:Cep126 UTSW 9 8100821 missense probably damaging 1.00
R4499:Cep126 UTSW 9 8101588 missense possibly damaging 0.80
R4585:Cep126 UTSW 9 8103337 missense probably damaging 0.99
R5547:Cep126 UTSW 9 8100427 missense probably damaging 0.97
R5752:Cep126 UTSW 9 8120745 nonsense probably null
R5794:Cep126 UTSW 9 8103439 missense possibly damaging 0.64
R5932:Cep126 UTSW 9 8103508 missense probably damaging 1.00
R5956:Cep126 UTSW 9 8112119 missense probably benign 0.08
R6354:Cep126 UTSW 9 8099927 missense probably damaging 1.00
R6442:Cep126 UTSW 9 8100563 missense probably benign 0.14
R6964:Cep126 UTSW 9 8112100 missense probably null 0.99
R7134:Cep126 UTSW 9 8103382 missense probably damaging 1.00
R7161:Cep126 UTSW 9 8087399 missense probably benign 0.02
R7221:Cep126 UTSW 9 8100987 nonsense probably null
R7338:Cep126 UTSW 9 8099798 missense possibly damaging 0.50
R7345:Cep126 UTSW 9 8099816 missense probably damaging 1.00
R7473:Cep126 UTSW 9 8101778 missense probably damaging 1.00
X0060:Cep126 UTSW 9 8087255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGGAACTGAGGCTAGGAGCCA -3'
(R):5'- ACACGGATTAGCTGTCCCACAAGA -3'

Sequencing Primer
(F):5'- GAATATAGACTTGGTCCTTTAGGCAG -3'
(R):5'- TGTCCCACAAGAGCCTTATGATG -3'
Posted On2013-10-16