Incidental Mutation 'R0835:Mroh1'
ID77849
Institutional Source Beutler Lab
Gene Symbol Mroh1
Ensembl Gene ENSMUSG00000022558
Gene Namemaestro heat-like repeat family member 1
SynonymsHeatr7a, D330001F17Rik
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76380261-76453038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 76451883 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1486 (V1486F)
Ref Sequence ENSEMBL: ENSMUSP00000094115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023217] [ENSMUST00000096385] [ENSMUST00000159218]
Predicted Effect probably benign
Transcript: ENSMUST00000023217
SMART Domains Protein: ENSMUSP00000023217
Gene: ENSMUSG00000022557

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
BOP1NT 130 388 1.38e-177 SMART
WD40 388 427 1.16e-9 SMART
WD40 430 469 6.16e0 SMART
WD40 508 551 7.1e1 SMART
WD40 554 592 4.46e-1 SMART
WD40 595 634 2.76e-2 SMART
WD40 638 677 4.14e-6 SMART
WD40 689 732 3.14e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096385
AA Change: V1486F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558
AA Change: V1486F

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159218
AA Change: V1477F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124811
Gene: ENSMUSG00000022558
AA Change: V1477F

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1346 1358 N/A INTRINSIC
low complexity region 1479 1493 N/A INTRINSIC
Pfam:HEAT 1601 1631 1.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160986
Predicted Effect probably benign
Transcript: ENSMUST00000161265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229897
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Mroh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Mroh1 APN 15 76432288 missense probably benign 0.01
IGL02141:Mroh1 APN 15 76446599 missense possibly damaging 0.47
IGL02146:Mroh1 APN 15 76434679 splice site probably benign
IGL02205:Mroh1 APN 15 76437239 missense possibly damaging 0.81
IGL02261:Mroh1 APN 15 76429160 missense probably benign 0.03
IGL02818:Mroh1 APN 15 76432401 splice site probably null
IGL02949:Mroh1 APN 15 76408968 missense probably damaging 0.97
IGL02951:Mroh1 APN 15 76427636 missense probably damaging 1.00
IGL03154:Mroh1 APN 15 76452838 missense probably damaging 1.00
IGL02799:Mroh1 UTSW 15 76392461 critical splice donor site probably null
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0076:Mroh1 UTSW 15 76451140 missense probably benign 0.00
R0180:Mroh1 UTSW 15 76428250 missense probably damaging 0.99
R0315:Mroh1 UTSW 15 76427600 missense possibly damaging 0.94
R0350:Mroh1 UTSW 15 76432249 missense probably damaging 0.98
R0399:Mroh1 UTSW 15 76452099 missense probably benign 0.44
R0893:Mroh1 UTSW 15 76408938 missense possibly damaging 0.62
R1109:Mroh1 UTSW 15 76446509 splice site probably benign
R1527:Mroh1 UTSW 15 76452263 missense probably benign 0.03
R1595:Mroh1 UTSW 15 76433530 splice site probably benign
R1900:Mroh1 UTSW 15 76433385 missense probably benign 0.00
R1901:Mroh1 UTSW 15 76436049 missense probably benign
R2223:Mroh1 UTSW 15 76408045 critical splice donor site probably null
R2415:Mroh1 UTSW 15 76421211 missense probably damaging 0.99
R3113:Mroh1 UTSW 15 76408536 splice site probably benign
R3437:Mroh1 UTSW 15 76433608 missense possibly damaging 0.92
R3618:Mroh1 UTSW 15 76452346 missense possibly damaging 0.55
R3833:Mroh1 UTSW 15 76401619 missense probably benign 0.08
R4073:Mroh1 UTSW 15 76407985 missense probably benign 0.13
R4156:Mroh1 UTSW 15 76402126 splice site probably null
R4276:Mroh1 UTSW 15 76393851 missense probably damaging 1.00
R4745:Mroh1 UTSW 15 76408530 critical splice donor site probably null
R5450:Mroh1 UTSW 15 76432347 intron probably benign
R5574:Mroh1 UTSW 15 76433931 missense probably benign
R5673:Mroh1 UTSW 15 76430181 missense probably damaging 1.00
R5970:Mroh1 UTSW 15 76451491 missense probably benign 0.24
R5993:Mroh1 UTSW 15 76446680 missense probably damaging 0.99
R6008:Mroh1 UTSW 15 76451357 missense possibly damaging 0.50
R6082:Mroh1 UTSW 15 76430223 missense probably benign 0.06
R6302:Mroh1 UTSW 15 76436119 critical splice donor site probably null
R7030:Mroh1 UTSW 15 76437317 missense probably benign 0.01
R7098:Mroh1 UTSW 15 76408457 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTAAGCTGCTTGACACCCAGAG -3'
(R):5'- CTGTGAGATAATGGGATGCTGAGCC -3'

Sequencing Primer
(F):5'- GAGGTCTAGCTTAACCCTCAG -3'
(R):5'- CTGAGCCTGAGGTCCTCTTG -3'
Posted On2013-10-16