Incidental Mutation 'R0835:Wnt7b'
ID77852
Institutional Source Beutler Lab
Gene Symbol Wnt7b
Ensembl Gene ENSMUSG00000022382
Gene Namewingless-type MMTV integration site family, member 7B
SynonymsWnt-7b
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85535437-85582473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85537777 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 228 (F228S)
Ref Sequence ENSEMBL: ENSMUSP00000023015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023015] [ENSMUST00000109424] [ENSMUST00000167968] [ENSMUST00000229191] [ENSMUST00000229495]
Predicted Effect probably damaging
Transcript: ENSMUST00000023015
AA Change: F228S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023015
Gene: ENSMUSG00000022382
AA Change: F228S

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
WNT1 40 349 1.29e-214 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109424
AA Change: F221S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105051
Gene: ENSMUSG00000022382
AA Change: F221S

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
WNT1 44 353 1.29e-214 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167968
AA Change: F154S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130627
Gene: ENSMUSG00000022382
AA Change: F154S

DomainStartEndE-ValueType
WNT1 1 282 1.21e-182 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229191
AA Change: F225S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000229495
AA Change: F154S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Among members of the human WNT family, this gene product is most similar to WNT7A protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null embryos die at midgestational stages due to placental abnormalities involving the fusion of the chorion and allantois. Mice homozygous for a truncated allele display neonatal lethality, respiratory failure, and lung hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Wnt7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02543:Wnt7b APN 15 85558896 splice site probably benign
R0243:Wnt7b UTSW 15 85558902 critical splice donor site probably null
R0735:Wnt7b UTSW 15 85537495 missense probably damaging 1.00
R1917:Wnt7b UTSW 15 85559080 missense probably damaging 1.00
R1919:Wnt7b UTSW 15 85559080 missense probably damaging 1.00
R3914:Wnt7b UTSW 15 85537858 missense possibly damaging 0.90
R5893:Wnt7b UTSW 15 85581374 intron probably benign
R7483:Wnt7b UTSW 15 85537414 missense possibly damaging 0.95
R7498:Wnt7b UTSW 15 85543679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGGCGACTTCTCGATGTACAC -3'
(R):5'- GGTCCCATTTCCTCATTAGGGCTG -3'

Sequencing Primer
(F):5'- GATGTACACCAGGTCCGTCTC -3'
(R):5'- CTATTCCTAGCAGCTCAGAGAGG -3'
Posted On2013-10-16