Incidental Mutation 'R0835:Myg1'
ID77854
Institutional Source Beutler Lab
Gene Symbol Myg1
Ensembl Gene ENSMUSG00000001285
Gene Namemelanocyte proliferating gene 1
SynonymsGamm1
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102331709-102338139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102332102 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 76 (V76M)
Ref Sequence ENSEMBL: ENSMUSP00000109312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001331] [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000113682] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000169637] [ENSMUST00000170627]
Predicted Effect probably damaging
Transcript: ENSMUST00000001331
AA Change: V73M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001331
Gene: ENSMUSG00000001285
AA Change: V73M

DomainStartEndE-ValueType
Pfam:UPF0160 41 161 4.8e-54 PFAM
Pfam:UPF0160 158 312 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001335
SMART Domains Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
SCOP:d1fxkc_ 12 58 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062492
SMART Domains Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113682
AA Change: V76M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109312
Gene: ENSMUSG00000001285
AA Change: V76M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPF0160 45 365 1.5e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164961
Predicted Effect probably benign
Transcript: ENSMUST00000165671
SMART Domains Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165717
SMART Domains Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 72 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166658
SMART Domains Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 22 143 8.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168805
Predicted Effect probably benign
Transcript: ENSMUST00000169637
SMART Domains Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 58 3.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170281
Predicted Effect probably benign
Transcript: ENSMUST00000170627
SMART Domains Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 7 99 4.6e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170713
Predicted Effect unknown
Transcript: ENSMUST00000171244
AA Change: V71M
SMART Domains Protein: ENSMUSP00000129494
Gene: ENSMUSG00000001285
AA Change: V71M

DomainStartEndE-ValueType
Pfam:UPF0160 41 209 1.7e-76 PFAM
Pfam:UPF0160 204 306 3.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171733
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display no gross abnormalities but altered sex-dependent anxiety-like behaviors in different tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Myg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Myg1 APN 15 102334338 missense probably benign 0.00
IGL02188:Myg1 APN 15 102337441 missense probably benign 0.08
IGL02373:Myg1 APN 15 102336833 missense probably damaging 0.99
IGL02885:Myg1 APN 15 102332159 missense probably damaging 1.00
IGL03066:Myg1 APN 15 102334366 unclassified probably benign
R0583:Myg1 UTSW 15 102337790 nonsense probably null
R0631:Myg1 UTSW 15 102331849 missense probably benign 0.00
R1016:Myg1 UTSW 15 102334351 missense possibly damaging 0.50
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1757:Myg1 UTSW 15 102331829 missense probably benign
R2400:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2428:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2429:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2431:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2997:Myg1 UTSW 15 102337510 missense probably null 1.00
R3683:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3826:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3827:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3829:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R4923:Myg1 UTSW 15 102331853 missense probably benign
R5363:Myg1 UTSW 15 102337824 missense probably benign 0.00
R5419:Myg1 UTSW 15 102336962 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGTGGTATCTTAACATTGCCGCTC -3'
(R):5'- GCAGTGGTCTTTGCTGTCATGAAC -3'

Sequencing Primer
(F):5'- TCCACTGCGATGAAGCTCTG -3'
(R):5'- CTGTCATGAACTTGGGCAGTG -3'
Posted On2013-10-16