Incidental Mutation 'R0836:Tgm3'
ID77882
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Nametransglutaminase 3, E polypeptide
SynonymsTG E
MMRRC Submission 039015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R0836 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130012349-130050399 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 130026682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
Predicted Effect probably benign
Transcript: ENSMUST00000110299
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aldh9a1 G A 1: 167,350,255 G7D probably benign Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Asphd2 A T 5: 112,391,769 L66H probably damaging Het
Astl T C 2: 127,342,419 F21L probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cadps2 T C 6: 23,328,776 probably benign Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Cfap43 C A 19: 47,815,846 V304L probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Cpa5 T C 6: 30,623,211 S124P probably damaging Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fezf1 T C 6: 23,246,999 H278R probably benign Het
Fhod3 T A 18: 25,066,218 Y649N probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itga2 A G 13: 114,856,679 V800A probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Kcnd2 T C 6: 21,726,239 probably benign Het
Kcnd2 T A 6: 21,727,329 V627E probably damaging Het
Ktn1 A G 14: 47,701,062 probably null Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Macf1 A G 4: 123,494,882 probably null Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Nfkbia C A 12: 55,490,776 A211S probably damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Pmch A G 10: 88,091,224 I30V probably benign Het
Ppat A C 5: 76,922,501 Y157D probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rbp3 T G 14: 33,956,638 S848A possibly damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rims1 T C 1: 22,427,459 probably null Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc34a2 A G 5: 53,067,707 T397A probably benign Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Sorcs3 G A 19: 48,487,394 V231I probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tax1bp1 C T 6: 52,741,940 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Thbs4 T G 13: 92,758,038 D659A probably damaging Het
Tmed11 A T 5: 108,795,309 M1K probably null Het
Tmpo A T 10: 91,161,953 C657* probably null Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Vmn2r17 A T 5: 109,427,956 H231L possibly damaging Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 130038413 missense probably damaging 1.00
IGL00924:Tgm3 APN 2 130038374 missense probably damaging 1.00
IGL01469:Tgm3 APN 2 130024494 missense probably damaging 1.00
IGL01722:Tgm3 APN 2 130044568 missense probably damaging 0.99
IGL01787:Tgm3 APN 2 130047740 missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 130024518 missense probably benign 0.02
IGL02437:Tgm3 APN 2 130030041 splice site probably null
IGL02449:Tgm3 APN 2 130038609 critical splice donor site probably null
IGL02992:Tgm3 APN 2 130041979 missense probably damaging 1.00
tortellini UTSW 2 130024585 critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 130048390 missense probably damaging 1.00
R0523:Tgm3 UTSW 2 130044662 critical splice donor site probably null
R0833:Tgm3 UTSW 2 130026682 splice site probably benign
R0834:Tgm3 UTSW 2 130026757 missense probably benign 0.00
R0940:Tgm3 UTSW 2 130012406 missense probably benign 0.00
R1354:Tgm3 UTSW 2 130041898 missense probably benign
R1642:Tgm3 UTSW 2 130047782 missense probably damaging 1.00
R1670:Tgm3 UTSW 2 130041768 nonsense probably null
R1715:Tgm3 UTSW 2 130026814 critical splice donor site probably null
R1944:Tgm3 UTSW 2 130029969 missense probably damaging 0.99
R2104:Tgm3 UTSW 2 130037483 missense probably benign 0.39
R3416:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 130044589 nonsense probably null
R4296:Tgm3 UTSW 2 130038413 missense possibly damaging 0.77
R4794:Tgm3 UTSW 2 130041955 missense probably benign 0.00
R4948:Tgm3 UTSW 2 130048320 missense probably benign 0.00
R5034:Tgm3 UTSW 2 130037484 missense possibly damaging 0.95
R5144:Tgm3 UTSW 2 130048282 missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 130026784 nonsense probably null
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6182:Tgm3 UTSW 2 130025301 nonsense probably null
R6219:Tgm3 UTSW 2 130038610 critical splice donor site probably null
R6901:Tgm3 UTSW 2 130041970 missense possibly damaging 0.95
R6969:Tgm3 UTSW 2 130042029 missense probably benign 0.06
R6980:Tgm3 UTSW 2 130026777 missense probably benign 0.17
R7282:Tgm3 UTSW 2 130024561 missense probably benign 0.00
R7317:Tgm3 UTSW 2 130048291 missense probably benign 0.09
X0065:Tgm3 UTSW 2 130024510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGAGTGGACTGCAATGTGCC -3'
(R):5'- TGATGGAGCAGAACTTCTCCTCCC -3'

Sequencing Primer
(F):5'- GGACTGCAATGTGCCATCTC -3'
(R):5'- attggcaaaatgggcaagg -3'
Posted On2013-10-16