Incidental Mutation 'R0836:Cacna2d4'
ID77905
Institutional Source Beutler Lab
Gene Symbol Cacna2d4
Ensembl Gene ENSMUSG00000041460
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms5730412N02Rik
MMRRC Submission 039015-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0836 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119236526-119352407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119307286 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 745 (R745W)
Ref Sequence ENSEMBL: ENSMUSP00000140197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000186622]
Predicted Effect probably damaging
Transcript: ENSMUST00000037434
AA Change: R770W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460
AA Change: R770W

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 7.3e-40 PFAM
VWA 296 481 4.37e-14 SMART
Pfam:Cache_1 494 586 1.1e-24 PFAM
low complexity region 837 849 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1000 1011 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186622
AA Change: R745W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460
AA Change: R745W

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 6.4e-44 PFAM
VWA 296 481 2.7e-16 SMART
Pfam:Cache_1 494 559 1.1e-7 PFAM
low complexity region 812 824 N/A INTRINSIC
low complexity region 950 959 N/A INTRINSIC
low complexity region 975 986 N/A INTRINSIC
low complexity region 1095 1118 N/A INTRINSIC
Meta Mutation Damage Score 0.35 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aldh9a1 G A 1: 167,350,255 G7D probably benign Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Asphd2 A T 5: 112,391,769 L66H probably damaging Het
Astl T C 2: 127,342,419 F21L probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Cadps2 T C 6: 23,328,776 probably benign Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Cfap43 C A 19: 47,815,846 V304L probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Cpa5 T C 6: 30,623,211 S124P probably damaging Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fezf1 T C 6: 23,246,999 H278R probably benign Het
Fhod3 T A 18: 25,066,218 Y649N probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itga2 A G 13: 114,856,679 V800A probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Kcnd2 T C 6: 21,726,239 probably benign Het
Kcnd2 T A 6: 21,727,329 V627E probably damaging Het
Ktn1 A G 14: 47,701,062 probably null Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Macf1 A G 4: 123,494,882 probably null Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Nfkbia C A 12: 55,490,776 A211S probably damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Pmch A G 10: 88,091,224 I30V probably benign Het
Ppat A C 5: 76,922,501 Y157D probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rbp3 T G 14: 33,956,638 S848A possibly damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rims1 T C 1: 22,427,459 probably null Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc34a2 A G 5: 53,067,707 T397A probably benign Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Sorcs3 G A 19: 48,487,394 V231I probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tax1bp1 C T 6: 52,741,940 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Thbs4 T G 13: 92,758,038 D659A probably damaging Het
Tmed11 A T 5: 108,795,309 M1K probably null Het
Tmpo A T 10: 91,161,953 C657* probably null Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Vmn2r17 A T 5: 109,427,956 H231L possibly damaging Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Cacna2d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cacna2d4 APN 6 119337933 splice site probably benign
IGL00469:Cacna2d4 APN 6 119268278 missense probably damaging 1.00
IGL00518:Cacna2d4 APN 6 119343575 missense probably damaging 1.00
IGL00946:Cacna2d4 APN 6 119271915 missense possibly damaging 0.82
IGL01447:Cacna2d4 APN 6 119242904 missense probably damaging 1.00
IGL01514:Cacna2d4 APN 6 119282173 splice site probably benign
IGL01576:Cacna2d4 APN 6 119281641 nonsense probably null
IGL01934:Cacna2d4 APN 6 119308768 missense probably damaging 1.00
IGL02231:Cacna2d4 APN 6 119277908 splice site probably benign
IGL02516:Cacna2d4 APN 6 119271870 splice site probably benign
IGL02688:Cacna2d4 APN 6 119270749 splice site probably null
IGL03110:Cacna2d4 APN 6 119236737 missense probably benign 0.05
IGL03365:Cacna2d4 APN 6 119271264 missense probably benign 0.15
saccharine UTSW 6 119345106 splice site probably benign
Steveo UTSW 6 119347252 critical splice donor site probably null
sussmann UTSW 6 119274318 missense probably damaging 1.00
R0139:Cacna2d4 UTSW 6 119278269 intron probably benign
R0157:Cacna2d4 UTSW 6 119312424 missense probably benign 0.00
R0158:Cacna2d4 UTSW 6 119236748 missense possibly damaging 0.68
R0245:Cacna2d4 UTSW 6 119308721 missense probably damaging 1.00
R0612:Cacna2d4 UTSW 6 119281718 splice site probably benign
R0659:Cacna2d4 UTSW 6 119345106 splice site probably benign
R0722:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0743:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0833:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0835:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0884:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1052:Cacna2d4 UTSW 6 119300333 missense probably damaging 1.00
R1168:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1170:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1451:Cacna2d4 UTSW 6 119236824 missense probably benign 0.01
R1564:Cacna2d4 UTSW 6 119241195 missense possibly damaging 0.67
R1809:Cacna2d4 UTSW 6 119270824 missense probably damaging 0.99
R1936:Cacna2d4 UTSW 6 119270761 missense possibly damaging 0.82
R2078:Cacna2d4 UTSW 6 119338116 missense probably benign 0.02
R2198:Cacna2d4 UTSW 6 119347259 splice site probably benign
R2280:Cacna2d4 UTSW 6 119350041 missense possibly damaging 0.85
R3757:Cacna2d4 UTSW 6 119241163 missense probably damaging 0.98
R3975:Cacna2d4 UTSW 6 119278173 intron probably null
R3976:Cacna2d4 UTSW 6 119278173 intron probably null
R4238:Cacna2d4 UTSW 6 119240708 missense probably null 1.00
R4591:Cacna2d4 UTSW 6 119298464 missense probably benign 0.02
R4856:Cacna2d4 UTSW 6 119278256 missense possibly damaging 0.90
R4899:Cacna2d4 UTSW 6 119268196 nonsense probably null
R5319:Cacna2d4 UTSW 6 119347252 critical splice donor site probably null
R5351:Cacna2d4 UTSW 6 119268201 missense probably damaging 1.00
R5366:Cacna2d4 UTSW 6 119274318 missense probably damaging 1.00
R5393:Cacna2d4 UTSW 6 119239054 missense probably benign 0.20
R5395:Cacna2d4 UTSW 6 119271418 missense possibly damaging 0.71
R5408:Cacna2d4 UTSW 6 119348791 missense probably damaging 1.00
R5603:Cacna2d4 UTSW 6 119244285 missense probably damaging 1.00
R5661:Cacna2d4 UTSW 6 119343531 missense probably benign
R5898:Cacna2d4 UTSW 6 119274231 missense probably damaging 1.00
R5928:Cacna2d4 UTSW 6 119281698 missense probably benign 0.06
R6186:Cacna2d4 UTSW 6 119281689 missense possibly damaging 0.94
R6218:Cacna2d4 UTSW 6 119239060 missense probably damaging 0.99
R6257:Cacna2d4 UTSW 6 119281619 critical splice acceptor site probably null
R6409:Cacna2d4 UTSW 6 119282228 missense probably damaging 0.99
R6931:Cacna2d4 UTSW 6 119282234 missense possibly damaging 0.49
R7221:Cacna2d4 UTSW 6 119236663 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCCTCTAACCAACTGTGTTGACCC -3'
(R):5'- AGCTCCGTAGCTGAAGGCATTG -3'

Sequencing Primer
(F):5'- ACTGTGTTGACCCAAGCCTG -3'
(R):5'- CCCCGTGTCTATGTCAGTGG -3'
Posted On2013-10-16