Incidental Mutation 'R0836:Epn2'
ID77935
Institutional Source Beutler Lab
Gene Symbol Epn2
Ensembl Gene ENSMUSG00000001036
Gene Nameepsin 2
SynonymsIbp2, 9530051D10Rik
MMRRC Submission 039015-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0836 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61517249-61579687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61519491 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 611 (N611S)
Ref Sequence ENSEMBL: ENSMUSP00000104352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001063] [ENSMUST00000108711] [ENSMUST00000108712] [ENSMUST00000108713] [ENSMUST00000178202] [ENSMUST00000179936]
Predicted Effect probably benign
Transcript: ENSMUST00000001063
AA Change: N572S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000001063
Gene: ENSMUSG00000001036
AA Change: N572S

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108711
AA Change: N554S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104351
Gene: ENSMUSG00000001036
AA Change: N554S

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 431 443 N/A INTRINSIC
low complexity region 475 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108712
AA Change: N611S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000104352
Gene: ENSMUSG00000001036
AA Change: N611S

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 488 500 N/A INTRINSIC
low complexity region 532 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108713
AA Change: N560S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104353
Gene: ENSMUSG00000001036
AA Change: N560S

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 437 449 N/A INTRINSIC
low complexity region 481 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148956
SMART Domains Protein: ENSMUSP00000122514
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
SCOP:d1eyha_ 2 35 1e-9 SMART
PDB:1EDU|A 2 37 5e-8 PDB
UIM 152 171 6.29e-1 SMART
UIM 177 196 2.48e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178202
AA Change: N572S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136553
Gene: ENSMUSG00000001036
AA Change: N572S

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179936
AA Change: N617S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000136950
Gene: ENSMUSG00000001036
AA Change: N617S

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 494 506 N/A INTRINSIC
low complexity region 538 562 N/A INTRINSIC
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with clathrin and adaptor-related protein complex 2, alpha 1 subunit. The protein is found in a brain-derived clathrin-coated vesicle fraction and localizes to the peri-Golgi region and the cell periphery. The protein is thought to be involved in clathrin-mediated endocytosis. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aldh9a1 G A 1: 167,350,255 G7D probably benign Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Asphd2 A T 5: 112,391,769 L66H probably damaging Het
Astl T C 2: 127,342,419 F21L probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cadps2 T C 6: 23,328,776 probably benign Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Cfap43 C A 19: 47,815,846 V304L probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Cpa5 T C 6: 30,623,211 S124P probably damaging Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fezf1 T C 6: 23,246,999 H278R probably benign Het
Fhod3 T A 18: 25,066,218 Y649N probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itga2 A G 13: 114,856,679 V800A probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Kcnd2 T A 6: 21,727,329 V627E probably damaging Het
Kcnd2 T C 6: 21,726,239 probably benign Het
Ktn1 A G 14: 47,701,062 probably null Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Macf1 A G 4: 123,494,882 probably null Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Nfkbia C A 12: 55,490,776 A211S probably damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Pmch A G 10: 88,091,224 I30V probably benign Het
Ppat A C 5: 76,922,501 Y157D probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rbp3 T G 14: 33,956,638 S848A possibly damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rims1 T C 1: 22,427,459 probably null Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc34a2 A G 5: 53,067,707 T397A probably benign Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Sorcs3 G A 19: 48,487,394 V231I probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tax1bp1 C T 6: 52,741,940 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Thbs4 T G 13: 92,758,038 D659A probably damaging Het
Tmed11 A T 5: 108,795,309 M1K probably null Het
Tmpo A T 10: 91,161,953 C657* probably null Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Vmn2r17 A T 5: 109,427,956 H231L possibly damaging Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Epn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Epn2 APN 11 61523086 missense probably benign 0.00
IGL01582:Epn2 APN 11 61521869 missense probably benign 0.00
IGL02375:Epn2 APN 11 61519671 missense probably damaging 1.00
IGL03213:Epn2 APN 11 61519684 missense probably damaging 0.99
R0400:Epn2 UTSW 11 61532696 splice site probably null
R0458:Epn2 UTSW 11 61546455 missense possibly damaging 0.89
R0471:Epn2 UTSW 11 61535308 missense probably damaging 1.00
R0833:Epn2 UTSW 11 61519491 missense probably benign 0.01
R1418:Epn2 UTSW 11 61523086 missense probably benign 0.00
R1699:Epn2 UTSW 11 61523188 nonsense probably null
R1743:Epn2 UTSW 11 61546411 missense possibly damaging 0.92
R4039:Epn2 UTSW 11 61546522 missense probably damaging 1.00
R4696:Epn2 UTSW 11 61535303 missense probably damaging 1.00
R4752:Epn2 UTSW 11 61546371 missense probably damaging 1.00
R4913:Epn2 UTSW 11 61534576 critical splice donor site probably null
R6053:Epn2 UTSW 11 61546497 missense probably damaging 1.00
R6302:Epn2 UTSW 11 61546486 missense probably damaging 1.00
R6455:Epn2 UTSW 11 61533641 missense probably damaging 1.00
R6669:Epn2 UTSW 11 61519558 missense probably benign 0.00
R7032:Epn2 UTSW 11 61546702 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCTCCTTTCCAGACCTCAGTAG -3'
(R):5'- AGTGTCTTCCAGTGGCTCATCCTG -3'

Sequencing Primer
(F):5'- TCTTTCACCAGGAAGCTGGAC -3'
(R):5'- TTACCAGGTGCTGCTGC -3'
Posted On2013-10-16