Incidental Mutation 'R0836:Sorcs3'
ID77972
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Namesortilin-related VPS10 domain containing receptor 3
Synonyms6330404A12Rik
MMRRC Submission 039015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R0836 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location48206025-48805505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48487394 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 231 (V231I)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
Predicted Effect probably benign
Transcript: ENSMUST00000078880
AA Change: V231I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: V231I

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aldh9a1 G A 1: 167,350,255 G7D probably benign Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Asphd2 A T 5: 112,391,769 L66H probably damaging Het
Astl T C 2: 127,342,419 F21L probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cadps2 T C 6: 23,328,776 probably benign Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Cfap43 C A 19: 47,815,846 V304L probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Cpa5 T C 6: 30,623,211 S124P probably damaging Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fezf1 T C 6: 23,246,999 H278R probably benign Het
Fhod3 T A 18: 25,066,218 Y649N probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itga2 A G 13: 114,856,679 V800A probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Kcnd2 T C 6: 21,726,239 probably benign Het
Kcnd2 T A 6: 21,727,329 V627E probably damaging Het
Ktn1 A G 14: 47,701,062 probably null Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Macf1 A G 4: 123,494,882 probably null Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Nfkbia C A 12: 55,490,776 A211S probably damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Pmch A G 10: 88,091,224 I30V probably benign Het
Ppat A C 5: 76,922,501 Y157D probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rbp3 T G 14: 33,956,638 S848A possibly damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rims1 T C 1: 22,427,459 probably null Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc34a2 A G 5: 53,067,707 T397A probably benign Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tax1bp1 C T 6: 52,741,940 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Thbs4 T G 13: 92,758,038 D659A probably damaging Het
Tmed11 A T 5: 108,795,309 M1K probably null Het
Tmpo A T 10: 91,161,953 C657* probably null Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Vmn2r17 A T 5: 109,427,956 H231L possibly damaging Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48683658 critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48748319 missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48603864 missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48767103 missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48796375 missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48790131 missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48794168 missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48535531 missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48654072 missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48704370 splice site probably benign
IGL02830:Sorcs3 APN 19 48723002 splice site probably null
IGL02943:Sorcs3 APN 19 48759938 missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48603894 missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48654044 missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48748319 missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48797517 critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48802698 nonsense probably null
R0646:Sorcs3 UTSW 19 48206295 missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48487406 missense probably benign
R0792:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48693994 missense probably damaging 1.00
R1253:Sorcs3 UTSW 19 48206736 missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48694001 critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48764181 missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48748359 critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48603875 missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48794274 missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48722925 missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48398711 missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48603904 missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48722956 missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48749373 missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48693914 missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48683597 missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48794163 missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48764148 missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48759951 missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48759845 critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48796472 splice site probably null
R5848:Sorcs3 UTSW 19 48788511 missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48749396 missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48796450 missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48398697 missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48759857 missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48790166 missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48802759 missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48764307 critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48788505 missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48713571 missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48693824 missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48749343 missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48705963 missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48772289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGCTCCAGCAGCTTCTTTC -3'
(R):5'- CTCTCCACAAGTGGTATGATCGCC -3'

Sequencing Primer
(F):5'- GGAAGAAGGCACATTAGTCTAATTTC -3'
(R):5'- AGTGGTATGATCGCCGTTGTG -3'
Posted On2013-10-16