Mutagenetix > Incidental Mutation

Incidental Mutation 'R0837:Pik3c2g'

77991

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

039016-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R0837 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

139591070-139915010 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 139903425 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000087657

SMART Domains

Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111868

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189374

SMART Domains

Protein: ENSMUSP00000139763
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206646

Predicted Effect

probably benign
Transcript: ENSMUST00000218528

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

96% (44/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563I02Rik	T	C	14: 60,333,375 (GRCm39)		probably benign	Het
4930579C12Rik	A	G	9: 89,050,260 (GRCm39)		noncoding transcript	Het
Adam34	T	A	8: 44,104,537 (GRCm39)	K369N	probably benign	Het
Ap1g1	T	C	8: 110,577,697 (GRCm39)	W481R	probably damaging	Het
Bicdl1	G	A	5: 115,869,351 (GRCm39)	P26S	probably benign	Het
Cacna1c	A	T	6: 118,607,231 (GRCm39)	C1224*	probably null	Het
Cpsf2	C	T	12: 101,963,501 (GRCm39)		probably benign	Het
Cyp11b2	G	A	15: 74,725,490 (GRCm39)	R210W	probably damaging	Het
Dock7	C	T	4: 98,877,495 (GRCm39)	V1048I	probably benign	Het
Dync2h1	C	A	9: 7,077,979 (GRCm39)	A2908S	probably benign	Het
Elane	A	G	10: 79,722,942 (GRCm39)	D116G	probably damaging	Het
Epb41l2	C	T	10: 25,383,714 (GRCm39)	R153C	probably damaging	Het
Gucy2c	G	A	6: 136,699,418 (GRCm39)	P617L	probably damaging	Het
H2ac21	G	A	3: 96,127,439 (GRCm39)	A70T	probably damaging	Het
Kcnq4	T	A	4: 120,604,058 (GRCm39)	I106L	probably benign	Het
Man2b1	A	G	8: 85,823,458 (GRCm39)	N931D	possibly damaging	Het
Mthfs	A	G	9: 89,097,443 (GRCm39)	E100G	probably damaging	Het
Mto1	A	T	9: 78,381,072 (GRCm39)	I639F	probably damaging	Het
Myo15a	A	G	11: 60,378,077 (GRCm39)	E177G	probably damaging	Het
Naip5	T	A	13: 100,367,251 (GRCm39)	M282L	probably benign	Het
Or10aa1	A	G	1: 173,870,053 (GRCm39)	D179G	probably damaging	Het
Prl7d1	T	A	13: 27,898,321 (GRCm39)	M64L	probably benign	Het
Prnp	A	T	2: 131,778,444 (GRCm39)	N32I	probably damaging	Het
Ptpn11	C	T	5: 121,287,174 (GRCm39)	V406I	probably benign	Het
Rab40c	G	A	17: 26,103,667 (GRCm39)	T151I	probably damaging	Het
Rb1cc1	T	A	1: 6,304,495 (GRCm39)		probably null	Het
Rnf145	T	C	11: 44,415,815 (GRCm39)	V10A	probably benign	Het
Rtn4rl2	T	C	2: 84,711,036 (GRCm39)	N70S	probably damaging	Het
Scaper	A	T	9: 55,766,326 (GRCm39)	C483*	probably null	Het
Sema4a	T	A	3: 88,360,405 (GRCm39)	Q58L	possibly damaging	Het
Slf1	T	C	13: 77,249,067 (GRCm39)		probably null	Het
Sycp1	G	T	3: 102,822,561 (GRCm39)	N364K	probably benign	Het
Tenm4	T	C	7: 96,545,482 (GRCm39)		probably benign	Het
Tnfaip2	A	G	12: 111,417,141 (GRCm39)	T537A	probably damaging	Het
Trappc12	A	G	12: 28,753,596 (GRCm39)	I573T	possibly damaging	Het
Ugt2b38	G	A	5: 87,559,632 (GRCm39)	T420I	probably damaging	Het
Ulk1	A	T	5: 110,937,411 (GRCm39)		probably benign	Het
Unc80	G	A	1: 66,688,103 (GRCm39)	C2367Y	possibly damaging	Het
Usp7	C	A	16: 8,521,366 (GRCm39)	G135C	probably damaging	Het
Vmn2r103	A	G	17: 20,014,189 (GRCm39)	Y327C	probably damaging	Het
Vmn2r28	T	A	7: 5,491,026 (GRCm39)	H407L	probably damaging	Het
Zfp804a	A	C	2: 82,089,506 (GRCm39)	T1112P	probably damaging	Het
Zfr2	A	G	10: 81,081,242 (GRCm39)	K431E	probably damaging	Het
Zfy1	A	T	Y: 725,850 (GRCm39)	Y638*	probably null	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139,841,851 (GRCm39)	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139,798,583 (GRCm39)	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139,700,467 (GRCm39)	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139,599,514 (GRCm39)	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139,700,467 (GRCm39)	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139,599,407 (GRCm39)	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139,806,081 (GRCm39)	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139,863,730 (GRCm39)	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139,798,526 (GRCm39)	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139,682,699 (GRCm39)	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139,913,554 (GRCm39)	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139,718,133 (GRCm39)	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139,612,654 (GRCm39)	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139,612,654 (GRCm39)	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139,612,652 (GRCm39)	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139,603,562 (GRCm39)	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139,805,096 (GRCm39)	missense
R0002:Pik3c2g	UTSW	6	139,714,471 (GRCm39)	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139,903,519 (GRCm39)	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139,639,441 (GRCm39)	missense	unknown
R0719:Pik3c2g	UTSW	6	139,606,723 (GRCm39)	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139,610,791 (GRCm39)	critical splice donor site	probably null
R0840:Pik3c2g	UTSW	6	139,841,798 (GRCm39)	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139,718,154 (GRCm39)	missense	probably benign
R1501:Pik3c2g	UTSW	6	139,789,796 (GRCm39)	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139,693,904 (GRCm39)	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139,612,634 (GRCm39)	intron	probably benign
R1907:Pik3c2g	UTSW	6	139,789,768 (GRCm39)	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139,846,112 (GRCm39)	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139,599,546 (GRCm39)	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139,801,012 (GRCm39)	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139,798,600 (GRCm39)	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139,599,385 (GRCm39)	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139,599,385 (GRCm39)	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139,801,018 (GRCm39)	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139,798,589 (GRCm39)	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139,612,608 (GRCm39)	intron	probably benign
R4108:Pik3c2g	UTSW	6	139,676,096 (GRCm39)	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139,787,407 (GRCm39)	intron	probably benign
R4474:Pik3c2g	UTSW	6	139,610,749 (GRCm39)	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139,665,732 (GRCm39)	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139,665,744 (GRCm39)	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139,881,711 (GRCm39)	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139,881,711 (GRCm39)	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139,714,505 (GRCm39)	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139,913,528 (GRCm39)	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139,789,657 (GRCm39)	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139,789,657 (GRCm39)	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139,841,928 (GRCm39)	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139,665,873 (GRCm39)	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139,665,873 (GRCm39)	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139,665,873 (GRCm39)	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139,665,873 (GRCm39)	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139,612,623 (GRCm39)	intron	probably benign
R5186:Pik3c2g	UTSW	6	139,599,016 (GRCm39)	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139,841,983 (GRCm39)	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139,599,121 (GRCm39)	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139,665,808 (GRCm39)	missense	probably benign
R5417:Pik3c2g	UTSW	6	139,682,669 (GRCm39)	missense	probably benign
R5435:Pik3c2g	UTSW	6	139,661,581 (GRCm39)	splice site	probably null
R5580:Pik3c2g	UTSW	6	139,603,531 (GRCm39)	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139,682,733 (GRCm39)	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139,714,436 (GRCm39)	missense
R5914:Pik3c2g	UTSW	6	139,599,477 (GRCm39)	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139,842,518 (GRCm39)	missense	probably damaging	1.00
R6046:Pik3c2g	UTSW	6	139,599,137 (GRCm39)	missense	probably damaging	0.96
R6298:Pik3c2g	UTSW	6	139,603,561 (GRCm39)	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139,665,724 (GRCm39)	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139,676,195 (GRCm39)	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139,841,899 (GRCm39)	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139,903,502 (GRCm39)	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139,599,061 (GRCm39)	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139,606,868 (GRCm39)	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139,805,990 (GRCm39)	missense
R7215:Pik3c2g	UTSW	6	139,700,589 (GRCm39)	missense
R7332:Pik3c2g	UTSW	6	139,841,981 (GRCm39)	missense
R7357:Pik3c2g	UTSW	6	139,610,791 (GRCm39)	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139,913,620 (GRCm39)	missense	unknown
R7385:Pik3c2g	UTSW	6	139,801,079 (GRCm39)	missense
R7455:Pik3c2g	UTSW	6	139,913,643 (GRCm39)	missense	unknown
R7651:Pik3c2g	UTSW	6	139,599,070 (GRCm39)	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139,842,470 (GRCm39)	missense
R7923:Pik3c2g	UTSW	6	139,610,791 (GRCm39)	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139,827,786 (GRCm39)	missense
R8005:Pik3c2g	UTSW	6	139,599,067 (GRCm39)	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139,881,782 (GRCm39)	missense	unknown
R8724:Pik3c2g	UTSW	6	139,913,619 (GRCm39)	missense	unknown
R8733:Pik3c2g	UTSW	6	139,714,426 (GRCm39)	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139,714,436 (GRCm39)	missense
R8888:Pik3c2g	UTSW	6	139,676,092 (GRCm39)	nonsense	probably null
R8931:Pik3c2g	UTSW	6	139,821,093 (GRCm39)	missense	probably benign	0.02
R9188:Pik3c2g	UTSW	6	139,599,401 (GRCm39)	missense	possibly damaging	0.94
R9336:Pik3c2g	UTSW	6	139,821,161 (GRCm39)	missense
R9383:Pik3c2g	UTSW	6	139,827,742 (GRCm39)	nonsense	probably null
R9524:Pik3c2g	UTSW	6	139,606,768 (GRCm39)	missense	probably damaging	0.99
R9531:Pik3c2g	UTSW	6	139,841,926 (GRCm39)	missense
R9630:Pik3c2g	UTSW	6	139,599,237 (GRCm39)	missense	possibly damaging	0.66
R9697:Pik3c2g	UTSW	6	139,913,517 (GRCm39)	missense	unknown
R9708:Pik3c2g	UTSW	6	139,606,865 (GRCm39)	missense	probably benign
R9717:Pik3c2g	UTSW	6	139,841,910 (GRCm39)	missense
RF015:Pik3c2g	UTSW	6	139,700,497 (GRCm39)	missense
RF032:Pik3c2g	UTSW	6	139,612,656 (GRCm39)	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139,805,984 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAGCATTCAGACCATTAAAGGCTCC -3'
(R):5'- CAAACTACCTGGACAGGCGATAACG -3'

Sequencing Primer
(F):5'- AGATGGAATATCTCTTTGACACTGGG -3'
(R):5'- TGGACAGGCGATAACGTATACTTAC -3'

Posted On

2013-10-16