Incidental Mutation 'R0837:Usp7'
ID78015
Institutional Source Beutler Lab
Gene Symbol Usp7
Ensembl Gene ENSMUSG00000022710
Gene Nameubiquitin specific peptidase 7
Synonyms2210010O09Rik
MMRRC Submission 039016-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0837 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location8689595-8792308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8703502 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 135 (G135C)
Ref Sequence ENSEMBL: ENSMUSP00000133398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160326] [ENSMUST00000160405] [ENSMUST00000161046] [ENSMUST00000172505]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159509
Predicted Effect probably benign
Transcript: ENSMUST00000160326
SMART Domains Protein: ENSMUSP00000124576
Gene: ENSMUSG00000022710

DomainStartEndE-ValueType
PDB:2F1Z|B 43 83 2e-18 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000160405
AA Change: G416C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124382
Gene: ENSMUSG00000022710
AA Change: G416C

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
MATH 111 217 4.27e-22 SMART
Pfam:UCH 254 559 5.7e-53 PFAM
Pfam:UCH_1 255 528 3.7e-22 PFAM
Pfam:USP7_ICP0_bdg 661 906 7.1e-79 PFAM
Pfam:USP7_C2 916 1127 4.9e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161046
AA Change: G376C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124093
Gene: ENSMUSG00000022710
AA Change: G376C

DomainStartEndE-ValueType
MATH 71 177 4.27e-22 SMART
Pfam:UCH 214 519 9.6e-60 PFAM
Pfam:UCH_1 215 488 5.1e-29 PFAM
Pfam:USP7_ICP0_bdg 620 866 5e-83 PFAM
Pfam:USP7_C2 875 1089 2.7e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162929
Predicted Effect probably damaging
Transcript: ENSMUST00000172505
AA Change: G135C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133398
Gene: ENSMUSG00000022710
AA Change: G135C

DomainStartEndE-ValueType
Pfam:UCH_1 5 247 1.7e-18 PFAM
Pfam:UCH 5 278 2.8e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173939
Meta Mutation Damage Score 0.0384 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 96% (44/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the peptidase C19 family, which includes ubiquitinyl hydrolases. This protein deubiquitinates target proteins such as p53 (a tumor suppressor protein) and WASH (essential for endosomal protein recycling), and regulates their activities by counteracting the opposing ubiquitin ligase activity of proteins such as HDM2 and TRIM27, involved in the respective process. Mutations in this gene have been implicated in a neurodevelopmental disorder. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele show embryonic growth arrest and die between E6.5 and E7.5. Mice homozygous for a conditional allele activated in neural cells exhibit complete neonatal lethality, absent gastric milk, uncoordinated movement and abnormalforebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T C 14: 60,095,926 probably benign Het
4930579C12Rik A G 9: 89,168,207 noncoding transcript Het
Adam34 T A 8: 43,651,500 K369N probably benign Het
Ap1g1 T C 8: 109,851,065 W481R probably damaging Het
Bicdl1 G A 5: 115,731,292 P26S probably benign Het
Cacna1c A T 6: 118,630,270 C1224* probably null Het
Cpsf2 C T 12: 101,997,242 probably benign Het
Cyp11b2 G A 15: 74,853,641 R210W probably damaging Het
Dock7 C T 4: 98,989,258 V1048I probably benign Het
Dync2h1 C A 9: 7,077,979 A2908S probably benign Het
Elane A G 10: 79,887,108 D116G probably damaging Het
Epb41l2 C T 10: 25,507,816 R153C probably damaging Het
Gucy2c G A 6: 136,722,420 P617L probably damaging Het
Hist2h2ab G A 3: 96,220,123 A70T probably damaging Het
Kcnq4 T A 4: 120,746,861 I106L probably benign Het
Man2b1 A G 8: 85,096,829 N931D possibly damaging Het
Mthfs A G 9: 89,215,390 E100G probably damaging Het
Mto1 A T 9: 78,473,790 I639F probably damaging Het
Myo15 A G 11: 60,487,251 E177G probably damaging Het
Naip5 T A 13: 100,230,743 M282L probably benign Het
Olfr433 A G 1: 174,042,487 D179G probably damaging Het
Pik3c2g G A 6: 139,957,699 probably benign Het
Prl7d1 T A 13: 27,714,338 M64L probably benign Het
Prnp A T 2: 131,936,524 N32I probably damaging Het
Ptpn11 C T 5: 121,149,111 V406I probably benign Het
Rab40c G A 17: 25,884,693 T151I probably damaging Het
Rb1cc1 T A 1: 6,234,271 probably null Het
Rnf145 T C 11: 44,524,988 V10A probably benign Het
Rtn4rl2 T C 2: 84,880,692 N70S probably damaging Het
Scaper A T 9: 55,859,042 C483* probably null Het
Sema4a T A 3: 88,453,098 Q58L possibly damaging Het
Slf1 T C 13: 77,100,948 probably null Het
Sycp1 G T 3: 102,915,245 N364K probably benign Het
Tenm4 T C 7: 96,896,275 probably benign Het
Tnfaip2 A G 12: 111,450,707 T537A probably damaging Het
Trappc12 A G 12: 28,703,597 I573T possibly damaging Het
Ugt2b38 G A 5: 87,411,773 T420I probably damaging Het
Ulk1 A T 5: 110,789,545 probably benign Het
Unc80 G A 1: 66,648,944 C2367Y possibly damaging Het
Vmn2r103 A G 17: 19,793,927 Y327C probably damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Zfp804a A C 2: 82,259,162 T1112P probably damaging Het
Zfr2 A G 10: 81,245,408 K431E probably damaging Het
Zfy1 A T Y: 725,850 Y638* probably null Het
Other mutations in Usp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Usp7 APN 16 8697975 missense probably damaging 0.96
IGL00496:Usp7 APN 16 8695113 missense probably damaging 0.99
IGL02113:Usp7 APN 16 8716513 critical splice donor site probably null
IGL02873:Usp7 APN 16 8695194 unclassified probably benign
IGL03036:Usp7 APN 16 8738214 missense probably benign 0.00
PIT4402001:Usp7 UTSW 16 8698495 missense probably benign
R0066:Usp7 UTSW 16 8691418 missense probably benign
R0400:Usp7 UTSW 16 8716632 splice site probably benign
R0483:Usp7 UTSW 16 8699262 missense probably damaging 1.00
R0625:Usp7 UTSW 16 8704982 missense probably benign 0.00
R0626:Usp7 UTSW 16 8693914 missense possibly damaging 0.54
R0967:Usp7 UTSW 16 8696654 unclassified probably benign
R1929:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2270:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2271:Usp7 UTSW 16 8698469 missense probably benign 0.00
R2272:Usp7 UTSW 16 8698469 missense probably benign 0.00
R3949:Usp7 UTSW 16 8716564 missense probably damaging 1.00
R4411:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4413:Usp7 UTSW 16 8708914 missense probably damaging 1.00
R4500:Usp7 UTSW 16 8695895 missense possibly damaging 0.89
R4651:Usp7 UTSW 16 8698414 intron probably benign
R4852:Usp7 UTSW 16 8756844 nonsense probably null
R5483:Usp7 UTSW 16 8698540 missense probably benign
R5610:Usp7 UTSW 16 8716510 splice site probably null
R5734:Usp7 UTSW 16 8701981 missense possibly damaging 0.91
R5964:Usp7 UTSW 16 8712102 missense possibly damaging 0.52
R6753:Usp7 UTSW 16 8696911 missense probably benign 0.25
R7171:Usp7 UTSW 16 8716526 missense probably benign 0.01
R7263:Usp7 UTSW 16 8696724 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCAGGAAATGTTCTGGTGAGGCAC -3'
(R):5'- GGGGAAGTTGCTGTTCATACTCTGC -3'

Sequencing Primer
(F):5'- tgatgggcagagacaggag -3'
(R):5'- CTGCCTGTGCTTGTACTTGA -3'
Posted On2013-10-16