Incidental Mutation 'R0838:Dpy19l1'
ID78046
Institutional Source Beutler Lab
Gene Symbol Dpy19l1
Ensembl Gene ENSMUSG00000043067
Gene Namedpy-19-like 1 (C. elegans)
Synonyms1100001I19Rik
MMRRC Submission 039017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0838 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location24411776-24503140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24432431 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 473 (T473A)
Ref Sequence ENSEMBL: ENSMUSP00000129575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115277] [ENSMUST00000142064] [ENSMUST00000170356]
Predicted Effect probably damaging
Transcript: ENSMUST00000115277
AA Change: T279A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110932
Gene: ENSMUSG00000043067
AA Change: T279A

DomainStartEndE-ValueType
Pfam:Dpy19 10 549 1.6e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142064
AA Change: T473A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119986
Gene: ENSMUSG00000043067
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 99 743 2e-247 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170356
AA Change: T473A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129575
Gene: ENSMUSG00000043067
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 42 69 N/A INTRINSIC
Pfam:Dpy19 98 743 5.5e-264 PFAM
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,468 S513P possibly damaging Het
2310057M21Rik T A 7: 131,361,806 M53L probably damaging Het
Adamts6 A G 13: 104,413,789 N638D possibly damaging Het
Amy2b T C 3: 113,151,001 noncoding transcript Het
Ap5s1 G A 2: 131,211,431 R45K probably damaging Het
Arap1 T C 7: 101,400,412 Y994H probably damaging Het
Arrdc3 A T 13: 80,889,247 probably benign Het
Bard1 G A 1: 71,030,653 T722M probably damaging Het
Ccdc88a A G 11: 29,400,285 Y89C probably damaging Het
Cd96 A G 16: 46,117,926 S59P probably damaging Het
Chit1 T A 1: 134,143,337 C51* probably null Het
Cilp2 G T 8: 69,881,719 H876Q probably benign Het
Cyld A G 8: 88,741,350 E722G probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dedd2 T C 7: 25,211,187 E188G probably benign Het
Dnah17 A T 11: 118,060,104 W2898R probably damaging Het
Fam228a T A 12: 4,735,002 H43L possibly damaging Het
Fkbp15 G T 4: 62,324,126 H530N probably damaging Het
Gga1 C T 15: 78,891,918 S387L probably damaging Het
Gm14124 T A 2: 150,269,300 C637S possibly damaging Het
Gm4868 A G 5: 125,848,623 noncoding transcript Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Itgb4 A C 11: 115,998,162 probably benign Het
Jag1 G A 2: 137,093,278 T388I probably damaging Het
Kcnh1 A G 1: 192,413,206 D551G probably damaging Het
Lrp2bp A G 8: 46,025,124 D270G possibly damaging Het
Map3k19 C A 1: 127,823,959 V552F probably benign Het
Mixl1 A T 1: 180,696,800 D71E probably benign Het
Myocd A G 11: 65,178,932 I694T probably benign Het
Nadk2 T A 15: 9,091,242 S198T probably benign Het
Npepps A T 11: 97,267,692 probably benign Het
Nt5c1b C T 12: 10,375,071 Q206* probably null Het
Olfr64 T A 7: 103,893,415 I107F probably benign Het
Orm1 A G 4: 63,345,157 Y69C probably damaging Het
Plscr4 T A 9: 92,471,760 probably benign Het
Pon1 G A 6: 5,175,758 T188I possibly damaging Het
Ppm1a T A 12: 72,784,320 H206Q probably benign Het
Prl8a1 G A 13: 27,574,025 R234C probably damaging Het
Rfx3 C T 19: 27,849,967 R73Q possibly damaging Het
Rims2 T C 15: 39,681,025 V1466A probably benign Het
Sec24d T A 3: 123,305,836 F319L probably benign Het
Slc15a4 A G 5: 127,617,003 S123P possibly damaging Het
Slc1a6 A T 10: 78,796,222 D294V probably damaging Het
Slc28a3 A T 13: 58,588,269 D38E probably benign Het
Stard3nl A G 13: 19,372,586 probably null Het
Stard9 A G 2: 120,700,842 T2527A probably damaging Het
Sult3a1 C T 10: 33,879,288 P283L probably damaging Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Txndc16 T C 14: 45,165,419 probably benign Het
Zdhhc8 A G 16: 18,224,566 L590S probably damaging Het
Zfp366 A G 13: 99,228,610 E93G possibly damaging Het
Zfp69 T C 4: 120,931,281 N279S probably benign Het
Zscan10 T C 17: 23,610,034 S407P possibly damaging Het
Other mutations in Dpy19l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Dpy19l1 APN 9 24481930 missense probably damaging 0.99
IGL00788:Dpy19l1 APN 9 24462568 splice site probably benign
IGL00959:Dpy19l1 APN 9 24423197 splice site probably null
IGL01646:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01647:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01713:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01715:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01743:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL01912:Dpy19l1 APN 9 24485069 missense probably damaging 0.99
IGL02417:Dpy19l1 APN 9 24475386 missense possibly damaging 0.48
IGL02629:Dpy19l1 APN 9 24438713 splice site probably benign
IGL02677:Dpy19l1 APN 9 24485072 missense probably damaging 1.00
IGL02949:Dpy19l1 APN 9 24421180 missense probably benign 0.44
IGL03067:Dpy19l1 APN 9 24438660 missense probably benign 0.00
R0066:Dpy19l1 UTSW 9 24414409 missense possibly damaging 0.95
R0207:Dpy19l1 UTSW 9 24453891 missense probably damaging 1.00
R0462:Dpy19l1 UTSW 9 24414349 missense probably benign 0.01
R0544:Dpy19l1 UTSW 9 24485110 splice site probably benign
R0749:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R1114:Dpy19l1 UTSW 9 24424776 missense probably benign 0.30
R1546:Dpy19l1 UTSW 9 24475384 missense probably damaging 0.98
R1767:Dpy19l1 UTSW 9 24462584 missense probably benign 0.35
R1926:Dpy19l1 UTSW 9 24473824 missense probably benign
R1933:Dpy19l1 UTSW 9 24434387 missense probably damaging 0.99
R2046:Dpy19l1 UTSW 9 24423159 missense probably damaging 0.98
R2101:Dpy19l1 UTSW 9 24482035 missense probably damaging 0.99
R4083:Dpy19l1 UTSW 9 24485048 missense possibly damaging 0.86
R4565:Dpy19l1 UTSW 9 24432388 missense probably null 1.00
R4649:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4652:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4653:Dpy19l1 UTSW 9 24482054 missense possibly damaging 0.94
R4669:Dpy19l1 UTSW 9 24432368 missense possibly damaging 0.94
R4746:Dpy19l1 UTSW 9 24450670 missense probably benign 0.29
R4769:Dpy19l1 UTSW 9 24426148 missense probably damaging 0.99
R4785:Dpy19l1 UTSW 9 24424823 missense probably damaging 1.00
R5177:Dpy19l1 UTSW 9 24438628 critical splice donor site probably null
R5466:Dpy19l1 UTSW 9 24414388 missense probably damaging 0.99
R5707:Dpy19l1 UTSW 9 24414267 makesense probably null
R6265:Dpy19l1 UTSW 9 24432371 missense possibly damaging 0.88
R6266:Dpy19l1 UTSW 9 24439146 missense probably damaging 0.99
R6290:Dpy19l1 UTSW 9 24462600 missense probably damaging 1.00
R6380:Dpy19l1 UTSW 9 24482045 nonsense probably null
R6478:Dpy19l1 UTSW 9 24450696 missense possibly damaging 0.88
R6581:Dpy19l1 UTSW 9 24447864 missense possibly damaging 0.68
R6756:Dpy19l1 UTSW 9 24473784 missense probably damaging 0.99
R6773:Dpy19l1 UTSW 9 24440772 missense probably damaging 0.97
R6795:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R6796:Dpy19l1 UTSW 9 24502862 missense possibly damaging 0.53
R7060:Dpy19l1 UTSW 9 24423123 missense possibly damaging 0.88
X0025:Dpy19l1 UTSW 9 24432380 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTCAACTGTGCCCTCTAGAAATG -3'
(R):5'- AGGGAAGAATCGAGTTGCCTTTCAC -3'

Sequencing Primer
(F):5'- GCCCTCTAGAAATGTCTTCCAAAATG -3'
(R):5'- ATCGAGTTGCCTTTCACAGGAG -3'
Posted On2013-10-16