Incidental Mutation 'R0838:Zscan10'
ID78073
Institutional Source Beutler Lab
Gene Symbol Zscan10
Ensembl Gene ENSMUSG00000023902
Gene Namezinc finger and SCAN domain containing 10
SynonymsZscan10, Zfp206
MMRRC Submission 039017-MU
Accession Numbers

Ncbi RefSeq: NM_001033425.3; MGI:3040700

Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R0838 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23600856-23611019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23610034 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 407 (S407P)
Ref Sequence ENSEMBL: ENSMUSP00000111171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095595] [ENSMUST00000115509] [ENSMUST00000117606] [ENSMUST00000118369] [ENSMUST00000120967] [ENSMUST00000122285] [ENSMUST00000123866] [ENSMUST00000129227] [ENSMUST00000138487] [ENSMUST00000148062]
Predicted Effect probably benign
Transcript: ENSMUST00000095595
AA Change: S517P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093255
Gene: ENSMUSG00000023902
AA Change: S517P

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 343 366 4.4e-2 SMART
ZnF_C2H2 378 400 5.59e-4 SMART
ZnF_C2H2 406 428 1.25e-1 SMART
ZnF_C2H2 434 456 2.05e-2 SMART
ZnF_C2H2 478 500 2.75e-3 SMART
low complexity region 507 521 N/A INTRINSIC
ZnF_C2H2 524 547 1.82e-3 SMART
ZnF_C2H2 553 575 3.16e-3 SMART
ZnF_C2H2 581 603 1.95e-3 SMART
ZnF_C2H2 609 631 4.17e-3 SMART
ZnF_C2H2 637 659 1.56e-2 SMART
ZnF_C2H2 665 687 2.4e-3 SMART
ZnF_C2H2 693 715 1.98e-4 SMART
ZnF_C2H2 726 748 1.58e-3 SMART
ZnF_C2H2 754 776 6.42e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115509
AA Change: S407P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111171
Gene: ENSMUSG00000023902
AA Change: S407P

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 233 256 4.4e-2 SMART
ZnF_C2H2 268 290 5.59e-4 SMART
ZnF_C2H2 296 318 1.25e-1 SMART
ZnF_C2H2 324 346 2.05e-2 SMART
ZnF_C2H2 368 390 2.75e-3 SMART
low complexity region 397 411 N/A INTRINSIC
ZnF_C2H2 414 437 1.82e-3 SMART
ZnF_C2H2 443 465 3.16e-3 SMART
ZnF_C2H2 471 493 1.95e-3 SMART
ZnF_C2H2 499 521 4.17e-3 SMART
ZnF_C2H2 527 549 1.56e-2 SMART
ZnF_C2H2 555 577 2.4e-3 SMART
ZnF_C2H2 583 605 1.98e-4 SMART
ZnF_C2H2 616 638 1.58e-3 SMART
ZnF_C2H2 644 666 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117606
SMART Domains Protein: ENSMUSP00000112460
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 147 1.73e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118369
SMART Domains Protein: ENSMUSP00000113757
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120967
AA Change: S485P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113386
Gene: ENSMUSG00000023902
AA Change: S485P

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 346 368 5.59e-4 SMART
ZnF_C2H2 374 396 1.25e-1 SMART
ZnF_C2H2 402 424 2.05e-2 SMART
ZnF_C2H2 446 468 2.75e-3 SMART
low complexity region 475 489 N/A INTRINSIC
ZnF_C2H2 492 515 1.82e-3 SMART
ZnF_C2H2 521 543 3.16e-3 SMART
ZnF_C2H2 549 571 1.95e-3 SMART
ZnF_C2H2 577 599 4.17e-3 SMART
ZnF_C2H2 605 627 1.56e-2 SMART
ZnF_C2H2 633 655 2.4e-3 SMART
ZnF_C2H2 661 683 1.98e-4 SMART
ZnF_C2H2 694 716 1.58e-3 SMART
ZnF_C2H2 722 744 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122285
SMART Domains Protein: ENSMUSP00000112559
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123866
SMART Domains Protein: ENSMUSP00000116748
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 2.38e-34 SMART
ZnF_C2H2 267 290 4.4e-2 SMART
ZnF_C2H2 302 324 5.59e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125912
Predicted Effect probably benign
Transcript: ENSMUST00000129227
AA Change: S281P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118987
Gene: ENSMUSG00000023902
AA Change: S281P

DomainStartEndE-ValueType
ZnF_C2H2 142 164 5.59e-4 SMART
ZnF_C2H2 170 192 1.25e-1 SMART
ZnF_C2H2 198 220 2.05e-2 SMART
ZnF_C2H2 242 264 2.75e-3 SMART
low complexity region 271 285 N/A INTRINSIC
ZnF_C2H2 288 311 1.82e-3 SMART
ZnF_C2H2 317 339 3.16e-3 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 4.17e-3 SMART
ZnF_C2H2 401 423 1.56e-2 SMART
ZnF_C2H2 429 451 2.4e-3 SMART
ZnF_C2H2 457 479 1.98e-4 SMART
ZnF_C2H2 490 512 1.58e-3 SMART
ZnF_C2H2 518 540 6.42e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133749
Predicted Effect probably benign
Transcript: ENSMUST00000138487
SMART Domains Protein: ENSMUSP00000114341
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 236 258 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148062
AA Change: S440P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120876
Gene: ENSMUSG00000023902
AA Change: S440P

DomainStartEndE-ValueType
Pfam:SCAN 37 88 7.5e-20 PFAM
low complexity region 128 149 N/A INTRINSIC
ZnF_C2H2 301 323 5.59e-4 SMART
ZnF_C2H2 329 351 1.25e-1 SMART
ZnF_C2H2 357 379 2.05e-2 SMART
ZnF_C2H2 401 423 2.75e-3 SMART
low complexity region 430 444 N/A INTRINSIC
ZnF_C2H2 447 470 1.82e-3 SMART
ZnF_C2H2 476 498 3.16e-3 SMART
ZnF_C2H2 504 526 1.95e-3 SMART
ZnF_C2H2 532 554 4.17e-3 SMART
ZnF_C2H2 560 582 1.56e-2 SMART
ZnF_C2H2 588 610 2.4e-3 SMART
ZnF_C2H2 616 638 1.98e-4 SMART
ZnF_C2H2 649 671 1.58e-3 SMART
ZnF_C2H2 677 699 6.42e-4 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit a pleiotropic phenotype including reduced weight, mild hypoplasia in the spleen, heart and long bones, eye malformations including microphthalmia, altered platelet counts, an activated immune status, and behavioral alterations. [provided by MGI curators]
Allele List at MGI

All alleles(357) : Targeted(5) Gene trapped(352)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,468 S513P possibly damaging Het
2310057M21Rik T A 7: 131,361,806 M53L probably damaging Het
Adamts6 A G 13: 104,413,789 N638D possibly damaging Het
Amy2b T C 3: 113,151,001 noncoding transcript Het
Ap5s1 G A 2: 131,211,431 R45K probably damaging Het
Arap1 T C 7: 101,400,412 Y994H probably damaging Het
Arrdc3 A T 13: 80,889,247 probably benign Het
Bard1 G A 1: 71,030,653 T722M probably damaging Het
Ccdc88a A G 11: 29,400,285 Y89C probably damaging Het
Cd96 A G 16: 46,117,926 S59P probably damaging Het
Chit1 T A 1: 134,143,337 C51* probably null Het
Cilp2 G T 8: 69,881,719 H876Q probably benign Het
Cyld A G 8: 88,741,350 E722G probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dedd2 T C 7: 25,211,187 E188G probably benign Het
Dnah17 A T 11: 118,060,104 W2898R probably damaging Het
Dpy19l1 T C 9: 24,432,431 T473A probably damaging Het
Fam228a T A 12: 4,735,002 H43L possibly damaging Het
Fkbp15 G T 4: 62,324,126 H530N probably damaging Het
Gga1 C T 15: 78,891,918 S387L probably damaging Het
Gm14124 T A 2: 150,269,300 C637S possibly damaging Het
Gm4868 A G 5: 125,848,623 noncoding transcript Het
Guk1 G A 11: 59,185,095 R146C probably damaging Het
Itgb4 A C 11: 115,998,162 probably benign Het
Jag1 G A 2: 137,093,278 T388I probably damaging Het
Kcnh1 A G 1: 192,413,206 D551G probably damaging Het
Lrp2bp A G 8: 46,025,124 D270G possibly damaging Het
Map3k19 C A 1: 127,823,959 V552F probably benign Het
Mixl1 A T 1: 180,696,800 D71E probably benign Het
Myocd A G 11: 65,178,932 I694T probably benign Het
Nadk2 T A 15: 9,091,242 S198T probably benign Het
Npepps A T 11: 97,267,692 probably benign Het
Nt5c1b C T 12: 10,375,071 Q206* probably null Het
Olfr64 T A 7: 103,893,415 I107F probably benign Het
Orm1 A G 4: 63,345,157 Y69C probably damaging Het
Plscr4 T A 9: 92,471,760 probably benign Het
Pon1 G A 6: 5,175,758 T188I possibly damaging Het
Ppm1a T A 12: 72,784,320 H206Q probably benign Het
Prl8a1 G A 13: 27,574,025 R234C probably damaging Het
Rfx3 C T 19: 27,849,967 R73Q possibly damaging Het
Rims2 T C 15: 39,681,025 V1466A probably benign Het
Sec24d T A 3: 123,305,836 F319L probably benign Het
Slc15a4 A G 5: 127,617,003 S123P possibly damaging Het
Slc1a6 A T 10: 78,796,222 D294V probably damaging Het
Slc28a3 A T 13: 58,588,269 D38E probably benign Het
Stard3nl A G 13: 19,372,586 probably null Het
Stard9 A G 2: 120,700,842 T2527A probably damaging Het
Sult3a1 C T 10: 33,879,288 P283L probably damaging Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Txndc16 T C 14: 45,165,419 probably benign Het
Zdhhc8 A G 16: 18,224,566 L590S probably damaging Het
Zfp366 A G 13: 99,228,610 E93G possibly damaging Het
Zfp69 T C 4: 120,931,281 N279S probably benign Het
Other mutations in Zscan10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zscan10 APN 17 23609461 missense probably damaging 0.98
IGL01353:Zscan10 APN 17 23609600 missense probably damaging 1.00
IGL02327:Zscan10 APN 17 23607572 splice site probably benign
IGL02556:Zscan10 APN 17 23608145 missense possibly damaging 0.90
FR4737:Zscan10 UTSW 17 23609445 small deletion probably benign
P0043:Zscan10 UTSW 17 23609620 nonsense probably null
R0345:Zscan10 UTSW 17 23610082 missense probably damaging 1.00
R0401:Zscan10 UTSW 17 23605915 missense probably damaging 1.00
R0699:Zscan10 UTSW 17 23608118 missense probably damaging 1.00
R0919:Zscan10 UTSW 17 23610007 missense probably damaging 0.99
R1940:Zscan10 UTSW 17 23609852 missense probably damaging 1.00
R4647:Zscan10 UTSW 17 23610340 missense probably benign
R4753:Zscan10 UTSW 17 23607234 missense probably damaging 0.99
R4971:Zscan10 UTSW 17 23607173 missense possibly damaging 0.67
R5110:Zscan10 UTSW 17 23609632 missense probably damaging 1.00
R5410:Zscan10 UTSW 17 23610421 missense probably damaging 1.00
R5516:Zscan10 UTSW 17 23609359 missense possibly damaging 0.66
R5871:Zscan10 UTSW 17 23607267 intron probably benign
R6109:Zscan10 UTSW 17 23607129 missense probably damaging 0.98
R6626:Zscan10 UTSW 17 23605857 missense probably damaging 1.00
R6750:Zscan10 UTSW 17 23607190 missense possibly damaging 0.49
R6846:Zscan10 UTSW 17 23605607 missense probably damaging 0.97
R7223:Zscan10 UTSW 17 23609482 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTAACGCATTCCTCTGAGCC -3'
(R):5'- GCTTCTCACCCGTATGAATCTGCTG -3'

Sequencing Primer
(F):5'- AACCAGGGTTTTCAGCGTC -3'
(R):5'- CTCGCCTAGTGTGGATCATTAG -3'
Posted On2013-10-16