Incidental Mutation 'R0825:Sync'
ID78170
Institutional Source Beutler Lab
Gene Symbol Sync
Ensembl Gene ENSMUSG00000001333
Gene Namesyncoilin
Synonyms1110057H03Rik, SNIP4
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129287617-129308559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129293397 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 74 (Y74C)
Ref Sequence ENSEMBL: ENSMUSP00000099659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102599]
Predicted Effect probably benign
Transcript: ENSMUST00000102599
AA Change: Y74C

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099659
Gene: ENSMUSG00000001333
AA Change: Y74C

DomainStartEndE-ValueType
low complexity region 65 75 N/A INTRINSIC
Filament 156 453 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146448
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes for one knock-out allele show reduced generation of isometric stress in skeletal muscle but a normal response to eccentric contraction-induced injury. Homozygotes for another knock-out allele show impaired contractility and increased skeletalmuscle damage under a forced exercise regime. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Slc15a5 C T 6: 138,018,089 C386Y possibly damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Sync
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Sync APN 4 129293951 missense probably damaging 0.99
PIT4354001:Sync UTSW 4 129306654 missense possibly damaging 0.71
R0017:Sync UTSW 4 129293744 missense probably damaging 1.00
R0017:Sync UTSW 4 129293744 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0846:Sync UTSW 4 129294104 missense probably benign 0.13
R3824:Sync UTSW 4 129294363 missense possibly damaging 0.95
R4151:Sync UTSW 4 129293726 nonsense probably null
R4166:Sync UTSW 4 129306742 intron probably benign
R4760:Sync UTSW 4 129293439 missense probably benign 0.01
R5753:Sync UTSW 4 129293386 nonsense probably null
R6120:Sync UTSW 4 129293751 missense probably damaging 1.00
R6578:Sync UTSW 4 129294267 missense probably damaging 1.00
R6860:Sync UTSW 4 129287790 critical splice donor site probably null
R7347:Sync UTSW 4 129294306 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TTCCTCTTCAGGAGTCAGAATCCCC -3'
(R):5'- CGGCTTGTACACACTGCTGGAAAC -3'

Sequencing Primer
(F):5'- GTCAGAATCCCCGAAGGAG -3'
(R):5'- ACTGCTGGAAACGAGCTTC -3'
Posted On2013-10-16