Incidental Mutation 'R0826:Optc'
ID78208
Institutional Source Beutler Lab
Gene Symbol Optc
Ensembl Gene ENSMUSG00000010311
Gene Nameopticin
Synonyms
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133897199-133907999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133905155 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 69 (K69R)
Ref Sequence ENSEMBL: ENSMUSP00000120568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124051] [ENSMUST00000149380] [ENSMUST00000153617]
Predicted Effect probably benign
Transcript: ENSMUST00000124051
AA Change: K69R

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120568
Gene: ENSMUSG00000010311
AA Change: K69R

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRRNT 176 206 2.22e-2 SMART
LRR 200 224 3.55e1 SMART
LRR_TYP 225 248 6.78e-3 SMART
LRR 249 271 4.21e1 SMART
LRR 295 318 1.76e1 SMART
LRR 319 339 3.36e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124245
Predicted Effect unknown
Transcript: ENSMUST00000126123
AA Change: K58R
SMART Domains Protein: ENSMUSP00000117086
Gene: ENSMUSG00000010311
AA Change: K58R

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 68 78 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
LRRNT 166 196 2.22e-2 SMART
LRR 190 214 3.55e1 SMART
LRR_TYP 215 238 6.78e-3 SMART
LRR 239 261 4.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149380
AA Change: K69R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115661
Gene: ENSMUSG00000010311
AA Change: K69R

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153617
AA Change: K69R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123262
Gene: ENSMUSG00000010311
AA Change: K69R

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160564
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opticin belongs to class III of the small leucine-rich repeat protein (SLRP) family. Members of this family are typically associated with the extracellular matrix. Opticin is present in significant quantities in the vitreous of the eye and also localizes to the cornea, iris, ciliary body, optic nerve, choroid, retina, and fetal liver. Opticin may noncovalently bind collagen fibrils and regulate fibril morphology, spacing, and organization. The opticin gene is mapped to a region of chromosome 1 that is associated with the inherited eye diseases age-related macular degeneration (AMD) and posterior column ataxia with retinosa pigmentosa (AXPC1). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased preretinal neovascularization in an oxygen-induced retinopathy model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Optc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Optc APN 1 133902108 missense probably damaging 1.00
IGL01900:Optc APN 1 133902129 missense possibly damaging 0.68
IGL01988:Optc APN 1 133906929 critical splice donor site probably null
IGL02070:Optc APN 1 133901176 missense probably damaging 1.00
IGL02859:Optc APN 1 133902061 missense probably damaging 1.00
IGL03166:Optc APN 1 133903792 splice site probably benign
R1728:Optc UTSW 1 133903796 splice site probably null
R1728:Optc UTSW 1 133905170 missense probably benign
R1729:Optc UTSW 1 133903796 splice site probably null
R1729:Optc UTSW 1 133905170 missense probably benign
R1730:Optc UTSW 1 133903796 splice site probably null
R1730:Optc UTSW 1 133905170 missense probably benign
R1739:Optc UTSW 1 133903796 splice site probably null
R1739:Optc UTSW 1 133905170 missense probably benign
R1762:Optc UTSW 1 133903796 splice site probably null
R1762:Optc UTSW 1 133905170 missense probably benign
R1783:Optc UTSW 1 133903796 splice site probably null
R1783:Optc UTSW 1 133905170 missense probably benign
R1784:Optc UTSW 1 133903796 splice site probably null
R1784:Optc UTSW 1 133905170 missense probably benign
R1785:Optc UTSW 1 133903796 splice site probably null
R1785:Optc UTSW 1 133905170 missense probably benign
R2049:Optc UTSW 1 133903796 splice site probably null
R2130:Optc UTSW 1 133903796 splice site probably null
R2131:Optc UTSW 1 133903796 splice site probably null
R2133:Optc UTSW 1 133903796 splice site probably null
R2141:Optc UTSW 1 133903796 splice site probably null
R2142:Optc UTSW 1 133903796 splice site probably null
R3436:Optc UTSW 1 133897879 missense probably damaging 1.00
R3437:Optc UTSW 1 133897879 missense probably damaging 1.00
R3711:Optc UTSW 1 133905081 missense probably benign 0.15
R3902:Optc UTSW 1 133897963 missense probably benign 0.10
R3930:Optc UTSW 1 133901182 nonsense probably null
R4078:Optc UTSW 1 133898349 missense probably damaging 1.00
R4523:Optc UTSW 1 133903754 missense possibly damaging 0.94
R4672:Optc UTSW 1 133897817 missense possibly damaging 0.48
R5113:Optc UTSW 1 133900977 splice site probably benign
R5176:Optc UTSW 1 133902084 missense probably benign 0.00
R5530:Optc UTSW 1 133905090 missense probably benign 0.01
R5692:Optc UTSW 1 133900976 splice site probably benign
R5819:Optc UTSW 1 133897879 missense probably damaging 1.00
R6208:Optc UTSW 1 133904999 missense probably damaging 1.00
R6828:Optc UTSW 1 133897867 missense probably damaging 1.00
R6859:Optc UTSW 1 133897816 missense possibly damaging 0.95
R6986:Optc UTSW 1 133897964 missense probably benign 0.00
X0025:Optc UTSW 1 133897911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGCCAGTTCTTCATAGTTGCTGAG -3'
(R):5'- TGTGGTGAAATGAGTAAGCCAGCC -3'

Sequencing Primer
(F):5'- AGATCAATGACCTCGTTGTAGTCC -3'
(R):5'- TGATGGATCACCACACTGTGAG -3'
Posted On2013-10-16