Incidental Mutation 'R0826:Lamc2'
ID78209
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Namelaminin, gamma 2
Synonymsnicein, 100kDa
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location153122756-153186447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153152082 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 199 (S199P)
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]
Predicted Effect probably damaging
Transcript: ENSMUST00000027753
AA Change: S199P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: S199P

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185328
Predicted Effect probably damaging
Transcript: ENSMUST00000185356
AA Change: S199P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: S199P

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153130056 missense probably benign 0.00
IGL00907:Lamc2 APN 1 153144651 missense probably benign 0.32
IGL02026:Lamc2 APN 1 153144736 splice site probably benign
IGL02335:Lamc2 APN 1 153166216 missense probably benign 0.00
IGL02568:Lamc2 APN 1 153166262 missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153152057 missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153136783 missense probably benign 0.10
IGL02827:Lamc2 APN 1 153139781 missense probably damaging 1.00
IGL03240:Lamc2 APN 1 153124125 missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153133757 splice site probably null
ANU74:Lamc2 UTSW 1 153131835 missense probably benign 0.00
R0279:Lamc2 UTSW 1 153130696 missense probably benign 0.01
R0528:Lamc2 UTSW 1 153124094 missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153133621 missense probably benign 0.02
R0650:Lamc2 UTSW 1 153143876 missense possibly damaging 0.88
R1015:Lamc2 UTSW 1 153166199 missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153166287 missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153150818 missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153166263 missense probably benign 0.11
R1525:Lamc2 UTSW 1 153130756 missense probably benign 0.00
R1602:Lamc2 UTSW 1 153127028 missense probably benign 0.00
R1631:Lamc2 UTSW 1 153158934 missense possibly damaging 0.95
R1633:Lamc2 UTSW 1 153141698 nonsense probably null
R1832:Lamc2 UTSW 1 153166187 missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153133597 critical splice donor site probably null
R1996:Lamc2 UTSW 1 153154470 missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153141765 missense probably benign 0.01
R2107:Lamc2 UTSW 1 153154386 splice site probably benign
R2130:Lamc2 UTSW 1 153127124 missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153126866 missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153133706 missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153130779 missense probably benign 0.21
R3772:Lamc2 UTSW 1 153124251 missense probably benign
R4616:Lamc2 UTSW 1 153166169 missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153154395 missense probably null 1.00
R4939:Lamc2 UTSW 1 153126836 missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153136805 missense probably benign
R5544:Lamc2 UTSW 1 153124053 missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153131890 missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153141594 missense probably benign 0.04
R5811:Lamc2 UTSW 1 153166253 missense possibly damaging 0.53
R6058:Lamc2 UTSW 1 153136829 missense probably benign 0.01
R6130:Lamc2 UTSW 1 153136777 missense probably benign 0.01
R6137:Lamc2 UTSW 1 153166153 missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6995:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6997:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R7000:Lamc2 UTSW 1 153166127 missense possibly damaging 0.72
R7018:Lamc2 UTSW 1 153136742 missense probably benign 0.00
R7145:Lamc2 UTSW 1 153130772 missense possibly damaging 0.95
R7148:Lamc2 UTSW 1 153185984 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGGGAAGCCACTGTCCTAGACAC -3'
(R):5'- CATCCAGTCGTCAAAGATGGGTCAG -3'

Sequencing Primer
(F):5'- gccactgtcctagaCACAAGTC -3'
(R):5'- ACAGTGGACACGCTCATTTG -3'
Posted On2013-10-16